Lyon Motard

Motos et Motards => Motos => Discussion démarrée par: Sam le 08 mai 2005 à 23:18:12

Titre: Vos montures en photos
Posté par: Sam le 08 mai 2005 à 23:18:12
Allez on recommence ! :-)

Mon p'tit SV en vadrouille :


et d'autres p'tites photos prises il y a quelques jours :
( (  ( (  ( (
Titre: Re : Vos montures en photos
Posté par: Globull le 08 mai 2005 à 23:26:57
et voici la mienne ! enfin ce qu'il en reste :


et voici la future : :D
Titre: Re : Vos montures en photos
Posté par: adrien le 08 mai 2005 à 23:38:35




voila ma belle

prepas arbre a came, cullasse, kité 650, ligne complete rs prod, carbu tm40, fourche d'husky, bras ar d'husky, amorto emc etc...
Titre: Re : Vos montures en photos
Posté par: marco le 09 mai 2005 à 09:42:51
Ma mienne à  moi ! :D




Promis, je posterai des photos plus jolies quand j'en aurais fait ! :D
Titre: Re : Vos montures en photos
Posté par: le 09 mai 2005 à 10:20:33
voila la mienne avant qu'elle me quitte:

( (

( (

EDIT by Sam : j'ai mis les vignettes ;-)
Titre: Re : Vos montures en photos
Posté par: le 09 mai 2005 à 10:33:33
Et pour changer... UN SV ! :D





Et enfin quelques photos qui rappelleront des souvenirs à  certains, dont le fameux SV S/N et la concentr' spéciale SV bleu de 99 ;-)



Titre: Re : Vos montures en photos
Posté par: kali le 09 mai 2005 à 14:51:47
Mon tracteur avant :

( (

Le même actuellement :

( (
Titre: Re : Vos montures en photos
Posté par: no69 le 09 mai 2005 à 19:21:59
ma monture
Titre: Re : Vos montures en photos
Posté par: frédéric fasolino le 10 mai 2005 à 21:13:08
une image de ma belle :

( (

EDIT : c'est bon, j'ai corrigé ;-)
Titre: Re : Vos montures en photos
Posté par: Philippe le 10 mai 2005 à 22:32:40

lestouil a écrit:
ah !

loupé pour la taille


pas grave je l'ai imprimé et collée au mur de ma chambre... lol
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 11 mai 2005 à 15:22:23
T1111 Lestouil ... y'en a pas beaucoup des comme çà  !
Elle est chouette.
Titre: Re : Vos montures en photos
Posté par: clo le 11 mai 2005 à 16:39:41
voici titine à  moi  :


et ma future   :D  :

Titre: Re : Vos montures en photos
Posté par: Sylv1 le 11 mai 2005 à 19:11:45

tout d'abord clin d'oeil a ma premiere moto: 1 svs 2001 violine nacrée....
( (

et voici ma belle actuelle ::
( (

ps: sam merci de faire apparaitre ces pu... de photos, le jour ou j'arriverai a en mettre une comme je veux j'paye ma tournée.........j'y'arrove jamais moa !!!

EDIT by Sam : c'est fait ;-)
Titre: Re : Vos montures en photos
Posté par: le 12 mai 2005 à 07:51:56
tes liens ne fonctionnent pas...   :-)
Titre: Re : Vos montures en photos
Posté par: zai le 12 mai 2005 à 08:23:43
sylv1 t'es mauvais..!!!
bouhhhhhh!!!!!!!  :-P  :-P  :-)

et voila toujours un pour te  :kc:

Titre: Re : Vos montures en photos
Posté par: frédéric fasolino le 12 mai 2005 à 19:31:06

lippe14 a écrit:

lestouil a écrit:
ah !

loupé pour la taille


pas grave je l'ai imprimé et collée au mur de ma chambre... lol

va falloir que je crée un fan club alors  :lol:
Titre: Re : Vos montures en photos
Posté par: frédéric fasolino le 12 mai 2005 à 19:32:20

lefalconoir a écrit:
T1111 Lestouil ... y'en a pas beaucoup des comme çà  !
Elle est chouette.

au dernière nouvelle , 2.
Titre: Re : Vos montures en photos
Posté par: Alex le 12 mai 2005 à 22:10:49
Bon ben je m'y colle aussi, comme pour les présentations, tiens ça devrait presque être un passage forcé  :-P

Profil avec le pot devil full baroufff; tiens pour la petite anecdote, je suis partit le WE dernier faire un petit tour dans le midi et j'ai pris mon baladeur histoire de pas trop me faire ch... sur la route ... ça n'a servi à  rien, je entendais à  peine les sons aigu, les grave était complètement masqué par le bruit du pot et du vent, enfin je dis ça mais tout le monde s'en fou en fait, mais c'est pas grave je l'ai dis, une petite tranche de vie du père Alex  :D

i :love: sa bouille à  ma svs, tiens autre anecdote (chui en forme ce soir, my life powaaaa), j'ai remplacé la tête de fourche suite à  une gamelle à  la con (tiens d'ailleurs je crois qu'il y a un team pour ça il faut que j'y fasse un saut) et j'en ai trouvé une de remplacement grà¢ce à  emoto (merci silent pour l'url) et la peinture est signé "un collègue à  papa" qui a fait un beau travail, merci, c'est ce qui explique que l'autocollant à  la con "SV650S" a giclé (me manque pas celui là )

SV650 powaaaaaaa, old & new generation j'adore cette photo de famille :-) , tiens d'ailleurs j'ai une anecdote, il y a bien longtemps, dans une galaxie lointaine très lointaine ... bon ok ...  :out:

Elle et moi, le coup de foudre, depuis, une grande histoire d'amour  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: NeNe le 14 mai 2005 à 16:21:20
celle qui viens de me faire craquer...

Titre: Re : Vos montures en photos
Posté par: Pascal le 14 mai 2005 à 18:37:06
 :love:  :oye:  :banana:  :freak:

Elle est pas belle????HINNNN?

( (
Titre: Re : Vos montures en photos
Posté par: eldarin le 14 mai 2005 à 18:38:29
Feloche !!!  a .+ pour une ballade !
Titre: Re : Vos montures en photos
Posté par: Sam le 14 mai 2005 à 19:12:29
Féloches pour l'acquisition saturne

PS : j'ai fait un peu de ménage sur le topic, et j'ai modifié ton post pour y mettre directement la vignette de l'image ;-)
Titre: Re : Vos montures en photos
Posté par: Pascal le 14 mai 2005 à 19:21:26
Merci Sam
J'en ai bavé, j'ai pas compris l'histoire des [img] tu m'expliqueras a l'occas quand on se fera une balade, sinon, je pourrais pas mettre le string. hé hé

 :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 22 mai 2005 à 22:48:38
Alors la mienne, c'est une :love: GSE :love: full power (47 chevaux) rouge de 1992, 49300 kms a ce jours, acheté en novembre 2004, elle me fera la saison 2005 et tres certainement 2006.
Les modifs prévues a ce jour:
-carenage rouge en cours de recherche histoire de lui donner un look sportif... :D
-amortisseur de 750 GSXR a bonbonne séparée pour une meilleure tenue de route (il sera mis dès que je serais déposer une roue arrière...)
-une ligne avec pot carbone Yoshimura (qui sera mis dès que j'aurais reussit a enlever ce p***** de pot afin de changer la laine a l'interieure, j'y arrive pà´... :upset: )
Et c'est tout pour l'instant!!!
Titre: Re : Vos montures en photos
Posté par: le 23 mai 2005 à 23:19:10
Une Honda sinon Rien !
Photo du CB Seven Fifty
Titre: Re : Vos montures en photos
Posté par: Guest le 24 mai 2005 à 23:53:47
La mienne
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 25 mai 2005 à 10:46:44
Bon alors je rééssaie la moto Adidas ...

Titre: Re : Vos montures en photos
Posté par: Globull le 25 mai 2005 à 11:15:18
moi j'l'aaaaaiiiiiiimmmmmmeeeee ta moto adidas le falco :love: lé trop belle :D
Titre: Re : Vos montures en photos
Posté par: zai le 25 mai 2005 à 14:02:40

lefalconoir a écrit:
Bon alors je rééssaie la moto Adidas ...


apres la 749 dark voici la RSV DARK FACTORY !!!
 :D  :D  :D  :-P
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 25 mai 2005 à 14:20:21

zai a écrit:
apres la 749 dark voici la RSV DARK FACTORY !!!

..... et bientà´t il y aura........  :sneaky:  :sneaky:  :sneaky:
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 25 mai 2005 à 19:24:05
Silent ? Y'aura quoi ? hein dis ?
Titre: Re : Vos montures en photos
Posté par: guillaume le 25 mai 2005 à 19:41:55
moi je sais moi je sais  :D
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 25 mai 2005 à 19:48:00
Si tu le sais tant mieux pour toi...
si tu le dis c'est mieux pour nous ...
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 25 mai 2005 à 19:51:10
Hihihi! c'est plus un secret...
Fini le (

 :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 25 mai 2005 à 19:58:00
Ah ben voilà  !
Une moto avec un moteur !!!  :-P
Titre: Re : Vos montures en photos
Posté par: eldarin le 25 mai 2005 à 20:01:55
Vi je confirme !  :-)
Titre: Re : Vos montures en photos
Posté par: Florent le 25 mai 2005 à 22:25:52
voila la mienne g enfin r
Titre: Re : Vos montures en photos
Posté par: Florent le 25 mai 2005 à 22:29:23
moi pas avoir compris mess parti tous seul mm pas fini de le taper enfin dc g disait voila la miene g enfin ramener des photos!!!!!!!!!! :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: teuf le 28 mai 2005 à 18:50:41
hello v essayer de vous presenter ma meule pour qui la connaisse pas deja
Titre: Re : Vos montures en photos
Posté par: teuf le 28 mai 2005 à 18:51:26
arf marche po  :upset:  :upset:
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 29 mai 2005 à 20:25:37
Bon ! j'ai lavé, photographié avec un appareil qui fonctionne, je peux mettre en ligne une photo moins naze, sans pixels trop visibles ...

( (
Titre: Re : Vos montures en photos
Posté par: Alex le 30 mai 2005 à 22:41:08

lefalconoir a écrit:
Bon ! j'ai lavé, photographié avec un appareil qui fonctionne, je peux mettre en ligne une photo moins naze, sans pixels trop visibles ...

Ouaaaaaaah elle est très jolie, j'aime beaucoup :love:
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 31 mai 2005 à 00:55:53
Je parlais de la photo de droite ...

Titre: Re : Vos montures en photos
Posté par: BibiHSav le 31 mai 2005 à 07:46:26
Au vu des photos, Lyon Mot aurait pu s'appeler le SV Club de Lyon  :D
Titre: Re : Vos montures en photos
Posté par: BibiHSav le 31 mai 2005 à 08:24:42
Aller une petite photo de la mienne
( (
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 31 mai 2005 à 13:32:45
Et çà  c'est du SV en courbe ?

Titre: Re : Vos montures en photos
Posté par: teuf le 31 mai 2005 à 14:49:01
hey quelqu'un pourrait me dire comment on fait pour coller une photo y arrive pas doit etre con ou c'est pas  :confused:  :confused:  :confused:
Titre: Re : Vos montures en photos
Posté par: Sam le 31 mai 2005 à 16:18:05
Tout est expliqué ici (
Titre: Re : Vos montures en photos
Posté par: Tonyo le 31 mai 2005 à 22:25:11

TEUF998 a écrit:
hey quelqu'un pourrait me dire comment on fait pour coller une photo y arrive pas doit etre con ou c'est pas  :confused:  :confused:  :confused:

Probablement !!!! :D :D hi hi hi !!!

Titre: Re : Vos montures en photos
Posté par: Tonyo le 31 mai 2005 à 22:27:11
elle est belle ta moto Flo... :love:
Titre: Re : Vos montures en photos
Posté par: le 02 juin 2005 à 09:14:20
coucou à  tous et toutes , voici la mienne :
Titre: Re : Vos montures en photos
Posté par: le 02 juin 2005 à 09:15:34
gros plan sur la selle...
Titre: Re : Vos montures en photos
Posté par: le 02 juin 2005 à 09:16:34
une dernière pour la route...
Titre: Re : Vos montures en photos
Posté par: teuf le 02 juin 2005 à 09:20:01
hello nouty tout le monde le sai que je suis pas tres moto japs mais la tienne et sympa sobre et efficace je trouve joile moto  :-)
Titre: Re : Vos montures en photos
Posté par: Florent le 03 juin 2005 à 10:49:44

Tonyo a écrit:
elle est belle ta moto Flo... :love:

merci du compliment :-)  :-)  :-)  au plaisir tonyo
Titre: Re : Vos montures en photos
Posté par: Florent le 03 juin 2005 à 10:53:08
franchement nouty ta brelle elle dechire moi j'adore :10:  :10:  :10:  :10:
Titre: Re : Vos montures en photos
Posté par: africa42 le 06 juin 2005 à 19:56:41
Ben c'est pas un Sv ..... moi un twin .. mais comment on colle une image :upset:
Titre: Re : Vos montures en photos
Posté par: Clochette le 06 juin 2005 à 20:09:37
tout bien expliqué ici (
Titre: Re : Vos montures en photos
Posté par: teuf le 06 juin 2005 à 20:11:56
v essayer de nouveaux de vous presenter ma meule

 ( (
Titre: Re : Vos montures en photos
Posté par: teuf le 06 juin 2005 à 20:24:06
( (
Titre: Re : Vos montures en photos
Posté par: nane le 07 juin 2005 à 22:38:41
quelques photos de ma bybylette depuis ma gamelles de dimanche....enfin si ca et l' informatique ca fait 5
Titre: Re : Vos montures en photos
Posté par: Sam le 07 juin 2005 à 22:41:37
Tu ne peux pas ajouter la photo, car elle est stocké sur msn, et n'est pas accessible à  tous (en plus du fait que ce genre de lien ne fonctionne pas sur le forum :-()
Mets la plutà´t sur ImageShack (
Titre: Re : Vos montures en photos
Posté par: hagaryo le 15 juin 2005 à 20:25:03
la mienne
Titre: Re : Vos montures en photos
Posté par: guillaume le 15 juin 2005 à 20:31:16
Superbe ta moto hagaryo, le seul truc dommage c'est la forme du pot. Trop avant-gardiste pour moi  :D
Titre: Re : Vos montures en photos
Posté par: guillaume le 15 juin 2005 à 20:34:06
allez j'y mets la mienne  8-)

Titre: Re : Vos montures en photos
Posté par: hagaryo le 15 juin 2005 à 20:34:38
Je me suis fait à  sa forme et surtout à  son bruit  :pouces: je sais même pas si je vais pas le garder.
Titre: Re : Vos montures en photos
Posté par: hagaryo le 15 juin 2005 à 20:36:09
Très bonne moto le R6 j'ai eu le modèle 2003 sur circuit c'est redoutable.
Titre: Re : Vos montures en photos
Posté par: guillaume le 15 juin 2005 à 20:37:09
et çà  c'est quand je double Silent  :lol:  :D

Titre: Re : Vos montures en photos
Posté par: guillaume le 15 juin 2005 à 20:39:21

hagaryo a écrit:
Très bonne moto le R6 j'ai eu le modèle 2003 sur circuit c'est redoutable.

Je préfère le design et les carbus des premiers modèles. J'ai pas encore eu l'occase de lui poser les roues sur circuit.  :-(
Bon j'arrête là  le pourrisage du post.  :D
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 16 juin 2005 à 14:43:21
@ hagaryo (@ gex 1000 plutà´t !) :  :love:
Titre: Re : Vos montures en photos
Posté par: Thomas ARMAND le 16 juin 2005 à 16:46:22
Je me lance.
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 16 juin 2005 à 16:47:47
Tom, tu t'es fait plaiz mon cochon!!!  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Thomas ARMAND le 16 juin 2005 à 16:59:53
C'est clair !!! C'est à  mon banquier que je n'ai pas fait plaiz !!

@Sam : Je cris que j'ai merdé dans le format et la taille de la photo !!

Titre: Re : Vos montures en photos
Posté par: Blutch le 16 juin 2005 à 17:06:17

tom69 a écrit:
Je cris que j'ai merdé dans le format et la taille de la photo !!

Crie plus fort, j'ai rien entendu :lol:

En tout cas, elle est magnifique :10:
Alors, ça fait quoi de rouler en Ducat ?
Titre: Re : Vos montures en photos
Posté par: Hurl le 16 juin 2005 à 17:11:15
tom69: belle bete  ;-) (je parle de la moto hein ?  :D )
Titre: Re : Vos montures en photos
Posté par: guillaume le 16 juin 2005 à 18:46:45
Ayé il a la moto du kéké  :lol: ...
Belle machine, j'ai hà¢te de la "re" voir demain, sans sa bulle haute et ses protège phare plastoque  :D
Titre: Re : Vos montures en photos
Posté par: Blutch le 16 juin 2005 à 18:56:40
Tom69 : futur grand adepte de la section "Mécanique" :kc:
Titre: Re : Vos montures en photos
Posté par: guillaume le 16 juin 2005 à 19:03:37

Blutch a écrit:
Tom69 : futur grand adepte de la section "Mécanique" :kc:

Enorme... :lol:  :lol:  :lol:  :D
Titre: Re : Vos montures en photos
Posté par: Thomas ARMAND le 17 juin 2005 à 08:39:29
Ca suffit les enfants, ici c'est un post pour afficher nos motos, pas pour tchatcher !!!
Pas de pourrissage de post, MERCI.
Titre: Re : Vos montures en photos
Posté par: teuf le 17 juin 2005 à 16:00:45
ma!! quel bella machina
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 17 juin 2005 à 16:07:13
ppfffffffffffffffff, moi aussi j'ai un bi rouge (bon c'est une gse... :-( )
Par contre j'ai une petite question, il les mets ou ces pieds le passager? autour de la taille du pilote?
Titre: Re : Vos montures en photos
Posté par: VFR01 le 17 juin 2005 à 16:20:50

TEUF998 a écrit:
ma!! quel bella machina

+1 :love:
Titre: Re : Vos montures en photos
Posté par: le 19 juin 2005 à 00:36:46

Ptitducky a écrit:
ppfffffffffffffffff, moi aussi j'ai un bi rouge (bon c'est une gse... :-( )
Par contre j'ai une petite question, il les mets ou ces pieds le passager? autour de la taille du pilote?

+1 c'est vrai ça le sds il les met o๠ces petit peton ??
Titre: Re : Vos montures en photos
Posté par: frédéric fasolino le 19 juin 2005 à 09:13:03
le quoi ?????

sds ??????

ça se pilote pas avec un sds cette moto  :D
Titre: Re : Vos montures en photos
Posté par: BibiHSav le 19 juin 2005 à 09:19:54
Les superbikes sont faites pour être monoposto.

Pour des raisons commerciales, Ducat fait une version biposto, mais franchement pour ce que ça sert et pour le confort que cela apporte, vaut mieux rester en monoposto sur une superbike.

En gros pour ceux qui veulent rouler avec SDS prière de s'orienter vers des bécanes plus adaptées lol
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 05 juillet 2005 à 20:43:23
Bon et bien voilà , enfin c'est fait, j'ai réalisé mon rêve  :banana:

Le 1 er mai dernier, j'ai ruiné lamentablement mon Z-750 qui n'avait que 8 mois... véhicule épave à  l'issue de l'expertise...

Au bout d'un peu plus de deux mois d'attente, me voici donc enfin l'heureux (et c'est rien de le dire :D!! ) propriétaire d'une Triumph Speed Triple Black Edition de '04 !!!
J'ai fait 200 km cet aprèm et déjà  je suis  :love:  :love:  :love:

La voici: Bye bye Kawette!!! Bonjour Triplette!!!  :D  :D  :D
:yeah:  :yeah:  :yeah:
'suis bien armé pour une bonne boubourre!!! qui qui veut ????
 :bdevil:  :bdevil:  :bdevil:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 05 juillet 2005 à 20:44:52
moi msieu,sui partant pour une bouboure!
Finalement tu aurais pu faire la ballade avec nous
Au sinon jolie moto
Titre: Re : Vos montures en photos
Posté par: le 05 juillet 2005 à 20:57:31
:-o  :love:
Titre: Re : Vos montures en photos
Posté par: guillaume le 05 juillet 2005 à 20:59:59
Enorme çà  mon Silent, elle est superbe, j'aime beaucoup, on va te surnommé bientà´t le Chevallier Noir, Full black, la moto, le casque, la tenue, le string?, la copine?   :D En tout cas, tu vas te plaisir avec de 3 cylindres qui apparaît comme le bon conpromis pour ton style de conduite pépère  :D Vivement que je vois la belle de visu.
Titre: Re : Vos montures en photos
Posté par: NeNe le 05 juillet 2005 à 21:00:09
de la bombe poto silent, ca me rappele des choses ca  :-(
Titre: Re : Vos montures en photos
Posté par: Blutch le 05 juillet 2005 à 21:03:15
Ce soir, le plus heureux, c'est bien notre Silent :yeah:
Elle est vraiment superbe :pouces:
Et puis pour une petite arsouillette, c'est quand tu veux ;-) Mais t'es sûr que tu veux pas attendre de l'avoir un peu mieux en mains :confused:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 05 juillet 2005 à 21:03:37

NeNe a écrit:
de la bombe poto silent, ca me rappele des choses ca  :-(

Héhéhé! ton Gex m'en rappelle d'autres  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Clochette le 05 juillet 2005 à 21:31:40
en effet c'est beau :roll:
Titre: Re : Vos montures en photos
Posté par: Pascal le 06 juillet 2005 à 01:52:23
Elle est MAGNIFIQUE sans deconner.......
Titre: Re : Vos montures en photos
Posté par: chewie le 06 juillet 2005 à 02:34:36
Vi, bien belle moto!!!!  

moi aussi ca me rappele des souvenirs  :D  :lol:

alors arsouille powaaaaaaaa !!!!!  :lol:  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: le 06 juillet 2005 à 09:38:27
Voila ma mienne après un tit coup de lavage qui ne lui a pas fait de mal ^^

Titre: Re : Vos montures en photos
Posté par: angelinez7 le 06 juillet 2005 à 09:40:48
elle est magnifique mon ptit silent !!!!!!!!!!!!
Felicitations !!!!!!!!!!
maintenant il ne te reste plus qu'a l'arroser !!!!!!!
quand est ce qu'on boit !!!? mdr !!!!  :pint:  :pint:  :pint:  :pint:  :pint:  :pint:  :pint:  :pint:  :pint: ???????? :-P  :-P  :-P  :-P  :D
Titre: Re : Vos montures en photos
Posté par: Guest le 06 juillet 2005 à 13:27:09
Silent ta nouvelle monture est tout simplement
Magnifica :love:  :love:  :love:
Titre: Re : Vos montures en photos
Posté par: le 06 juillet 2005 à 14:14:42
C'est pas juste il y en a que pour Silent ... je rigole  :lol:  :lol:  :lol:

C'est vrai qu'elle est superbe :love: :love: :love: :love:
Titre: Re : Vos montures en photos
Posté par: Clochette le 06 juillet 2005 à 14:28:38
@proverb: mais non toute lavée elle est belle ta laguna :D

Titre: Re : Vos montures en photos
Posté par: chewie le 06 juillet 2005 à 14:32:48

Clochette a écrit:
@proverb: mais non toute lavée elle est belle ta laguna :D


tu m'as enleve les mots du clavier...  :lol:  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Hurl le 06 juillet 2005 à 20:14:08
Joli speed silent :pouces:
Bien propre en plus!

Je suis que tu va vouloir montrer popol à  toutes les filles maintenant :lol:  



Clochette a écrit:
@proverb: mais non toute lavée elle est belle ta laguna :D

PTDR  :lol:  :lol:  :lol:  :pouces:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 06 juillet 2005 à 20:17:11

Hurl a écrit:
Je suis que tu va vouloir montrer popol à  toutes les filles maintenant :lol:  

Mékilécon lui  :lol:  :lol:  :lol:  !!!!!

@proverb: comment tu réussis à  faire des burns avec ton VFR sachant que je freinage est couplé  :confused:  T'as du ruiner ton disque et tes plaquettes arrière ??? :-o
Titre: Re : Vos montures en photos
Posté par: Clochette le 06 juillet 2005 à 20:19:45
ca pète les 5 étoiles de shérif
et modérateur :D  :D  8-)
Titre: Re : Vos montures en photos
Posté par: le 06 juillet 2005 à 21:56:15
Non je n'ai pas ruiné mes disques en faisant mon burn.

Le system de couplage ne fonctionne qu'en mouvement.
Je m'explique, le maitre cylindre qui actionne le freinage arrière est monté de telle manière que lorsque tu freine de l'avant le frottement des plaquettes sur le disque mette en mouvement le système de maintients d'un des etriers avant, compressant ainsi le maitre cylindre qui fais freiner de l'arrière ^^


Enfin bref ... je te montrerais ca à  l'occas
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 06 juillet 2005 à 21:59:17
oki oki, je savais pas  ;-)  tout s'explique  :D
Titre: Re : Vos montures en photos
Posté par: le 07 juillet 2005 à 18:52:55
:eek2:  :eek2:  Mais que vois-je Silent a une nouvelle monture.

ça veut dire que je vais enfin essyer une anglaise, hein poto Silent t'oublies pas ta promesse  :D
Titre: Re : Vos montures en photos
Posté par: le 22 juillet 2005 à 00:44:18
Voila ma nouvelle monture !!!
Fraichement reviendue de Toulouseu con ^^

( ( ( (
cliquer pour agrandir

PS: ma laguna est donc en vente euh pardon mon VFR ^^ :-P  :-P
Le liens ici (

EDIT by Sam : ajout des vignettes, car images superieures à  1024 px
Titre: Re : Vos montures en photos
Posté par: Hurl le 22 juillet 2005 à 08:01:13
Sympa  ;-)
Titre: Re : Vos montures en photos
Posté par: Christophe le 25 juillet 2005 à 15:40:10
Slt a tous .............

Bon, je vous post la photo de "ma belle" ce soir !! car la suis au taf, alors forcement  ............. :lol:
Titre: Re : Vos montures en photos
Posté par: Christophe le 25 juillet 2005 à 21:58:26
la voila !!!!!

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 25 juillet 2005 à 22:01:33
Elle a l'air très très propre  :-)
Combien de bornes elle a? c'est pour satisfaire la curiosité de Guillaume  :lol:
Titre: Re : Vos montures en photos
Posté par: Christophe le 25 juillet 2005 à 22:03:57
Merci, c'est un modele 2003 avec 18000 bornes
Titre: Re : Vos montures en photos
Posté par: Sylvie le 27 juillet 2005 à 19:52:07
dingue, j vais pouvoir mettre ma mienne !!!
terrible non ??
bah oui !
donc, voilà 
 hem , je vous présente :
heuu ...
ma moto ...
jaune ...
mon CB 500 Sport !
( (

vache on dirait qu il est plus petit en vrai !!!!!!!! :-o  :-o  :-o  :-o
 :lol:  :lol:  :lol:  :lol:  :lol:
on dirait qu elle est neuve, hein ???
à  part peinture qui part sur le bloc moteur et petite érafleure!

( (

vache !!! l est grande!!! z avez un écran  16/9eme ????
bon bref, voilà  ma tout première moto de moi !
 :-)  :-)  :-)  :-)  :-)  :lol:  :lol:

EDIT by Sam : remplacement par les vignettes car images > 1024 px
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 27 juillet 2005 à 19:56:42
ohhhh!!! Des posters...
Titre: Re : Vos montures en photos
Posté par: Sylvie le 27 juillet 2005 à 19:58:10
oui tu pourras les afficher au dessus de ton lit, Ptiducky ! :lol:  :lol:  :lol:  :lol:

Bon y a a changer les retros , les clignos arriere, et la bavette arriere ...sinon,elle est pà´ mal  non ?
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 27 juillet 2005 à 19:58:57
Vouiiiii!!! des posters géants comme le journal Pif Gadget et Spirou!!!!!!  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Sylvie le 27 juillet 2005 à 20:00:21

Silent Phong a écrit:
Vouiiiii!!! des posters géants comme le journal Pif Gadget et Spirou!!!!!!  :lol:  :lol:  :lol:

moi qui croyait qu j allais m faire engueuler par Monsieur le Modo ! :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 27 juillet 2005 à 20:00:56
Qu'est ce qu'ils ont les retros et les clignos?
Moi je les trouve bien
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 27 juillet 2005 à 20:04:57

Lily a écrit:
moi qui croyait qu j allais m faire engueuler par Monsieur le Modo ! :D  :D  :D

Bah non, moi je dis rien, je sais pas comment on édite une photo pareille, mais Sam elle va être furax et pitèt même qu'elle va se transmuter!!!  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Sylvie le 27 juillet 2005 à 20:05:21
les clignos arrieres dépassent d au moins 2 mètres !!!!!
sont affreuuuuuuuuuuxxxxxxxxxxxxx!
et les rétros sont ovales !!!
sont affreuxxxxxxxxxxxxxxxxxxxxxx!
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 27 juillet 2005 à 20:08:44
Et si tu faisais péter un guidon street, un PDR ermax et au diable les rétros???  :D

ps: une durite aviat pour le frein avant, c'est pas cher et ça vraiment le coup...
Titre: Re : Vos montures en photos
Posté par: Sylvie le 27 juillet 2005 à 20:10:34
kesssssiiiiiddiiiiiiiiii le moooodoooooo ???
 :confused:  :confused:  :confused:

première moto moi !!
pas comprendre langage technique moto
(okok j avoue je lis pas tous les articles de moto journal, ca va hein z allez pas m engueler non plus !!)

 :D  :confused:  :confused:

c est écrit juste en dessous là  ... tu vois ? :D  :D
Titre: Re : Vos montures en photos
Posté par: Pierre le 28 juillet 2005 à 09:40:33

Passage obligé du petit nouveau, il y en a déjà  eu dans ma ma présentation, mais je vous remets quand meme quelques photos..

Un 600 Fazer, année 2000, 33 000km aujourd'hui.
Elle est toute d'origine, ou plutot je l'ai acheté tel quel.. :D

Place aux photos:

Vue d'ensemble, le Fazer nu j'accroche pas trop, mais là  ça a été le coup de foudre..



Clignos, ecope de radiateur, selle perso..

Pot Leo Vince, leche roue, clignos..

Et enfin le sabot..

Aucune modifs a prévoir.. Plus qu'à  en prendre bien soin comme son propriétaire précédent..
Titre: Re : Vos montures en photos
Posté par: Tonyo le 04 août 2005 à 10:13:50
Well, beh j'ai pas encore mis la mienne de moto...
Pour ceux qui savent pas, c'est une SV 650 S jaune de 2004...

( (

Et la prochaine....
800 SS 2003 avec fourche réglable dans tous les sens... je vais jamais y toucher mais bon... et bien sur... Jaune... :D

Pastagaa powwwoooooooaaaaaa

( (
3/4 profil avant

( (
De derrière (beau cul d'ailleurs...)

( (
de 3/4 profil de cul...

Voila pour les photos, maintenant reste plus qu'à  aller la chercher !!!

Mais c'est surtout le bruit, le son Ducati... roooo

vivement bientot tiens... hi hi !!!
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 04 août 2005 à 10:24:27
Oh :-o une plaque NH...
Titre: Re : Vos montures en photos
Posté par: Sam le 04 août 2005 à 11:06:18
> Tonyo : Je suis jalouse... moi aussi j'veux un SSeeeuuuhhh.

En tout cas elle a l'air nickel. Vivement que tu l'aies :-)
Titre: Re : Vos montures en photos
Posté par: VFR01 le 04 août 2005 à 11:07:58

Sam a écrit:
> Tonyo : Je suis jalouse... moi aussi j'veux un SSeeeuuuhhh.

En tout cas elle a l'air nickel. Vivement que tu l'aies :-)

c'est vrai qu'elle a l'air propre bon choix  :pouces: meme la plaque d'immat  :lol:
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 04 août 2005 à 11:26:37
Alors là  Tonio BRAVO !
Une vraie sportive qui tient le parquet et donne la :banana: sans attendre 10000 trs/mn et 250 Km/h.
Et aux régimes intermédiaires ... quel moteur !

(par contre aà¯e les poignets !!!)

Je te la souhaite rapidement.
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 04 août 2005 à 12:11:23
( (
Sûr qu'avec les pots Ducat'Perfo elle doit sortir un très joli bruit :pouces:

Quant à  ton Fazer Ptitpom, il a l'air vraiment très très propre!!!
Full Black Powaaaaaaaaaaaaa!!!!!!!!  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: fabien le 04 août 2005 à 15:22:35
la dayto


la calif :


pour la 400 ... j'ai la flemme ... voir mon site :)
Titre: Re : Vos montures en photos
Posté par: Clochette le 04 août 2005 à 15:30:06

fabien a écrit:
pour la 400 ... j'ai la flemme ... voir mon site :)

ok mais il ne fonctionne pas....!!! :confused:
Titre: Re : Vos montures en photos
Posté par: chewie le 04 août 2005 à 16:11:27

fabien a écrit:
la dayto


j'adore ce model de dayto et surtout en jaune  :love:  :love:  :love:

bon ok, j'suis po objectif parce que j'ai eu la meme (sans le titi)
pour moi la meilleur moto que j'ai eu !!!! mais j'veux plus de carenage...  :roll:
Titre: Re : Vos montures en photos
Posté par: Sam le 04 août 2005 à 16:20:37
moi aussi j'préfère ce modèle, mais en noir... :D
Titre: Re : Vos montures en photos
Posté par: Christophe le 04 août 2005 à 16:42:36
Elle est super belle, mais le "titi" fait un peu desordre ........

cela n'angage que moi, bien sur..... ;-)
Titre: Re : Vos montures en photos
Posté par: nuts le 04 août 2005 à 18:48:18
dit pourquoi tu met ta brel sur le site :confused:  alors qu'on sait meme pas qui tu est  :roll:  genre:

salut moi c'est ANONYME et voila LA MIENNE  :-o
Titre: Re : Vos montures en photos
Posté par: Hurl le 04 août 2005 à 18:53:46

nuts a écrit:
dit pourquoi tu met ta brel sur le site :confused:  alors qu'on sait meme pas qui tu est  :roll:  genre:

salut moi c'est ANONYME et voila LA MIENNE  :-o

gni  :confused:

Qu'est ce qui t'arrives nuts ? Un souci ?

Vas-y, parles nous  :-)
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 04 août 2005 à 18:56:53
euh,... là , j'avoue que je comprend pas moi aussi... :roll:
Titre: Re : Vos montures en photos
Posté par: nuts le 04 août 2005 à 19:02:20
c'est juste que quand on presente sa moto on pourrais aussi presenter le proprio y'avais rien de mechant la dedans
excusé moi si je me suis mal exprimé :-(
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 04 août 2005 à 19:04:08
ben il l'a fait ICI (

jti comprend pà´...
Titre: Re : Vos montures en photos
Posté par: nuts le 04 août 2005 à 19:08:45
d'accore je vois ou ce trouve le chisme je suis nouveau sur le site donc je passe toute les presentation en revues. on en est a la page 14 et a la page 3 entre dougui et lefalconoir il y as ANONYME et sa brelle
bon a plus y faut que j'y aille et encore 1000 excuse
Titre: Re : Vos montures en photos
Posté par: Sam le 04 août 2005 à 19:12:01
En fait il s'agit de l'ancien compte de laboulette qui avait été supprimé (le pseudo est alors remplacé par Anonyme).
Titre: Re : Vos montures en photos
Posté par: Globull le 04 août 2005 à 19:12:18

Toutoune a écrit:
Elle est super belle, mais le "titi" fait un peu desordre ........

cela n'angage que moi, bien sur..... ;-)

t'as un probleme contre les titi ???

non parce que rien qu'avec moi tu va avoir des soucis si t'aime pas les titi, pis apres ya mon poto le chticanard qui va en remettre une couche (mm s'il fait pas bien peur, il fait mal) et pis ya plein d'autre gens qui adorent les titi ici et ils vont pas être content ... et ... :D :D :D

quoi ? deja ????!!!! mais j'viens a peine d'arriver ?! ... comment ça j'ai des basket ?! et alors ???

bon bon( mdrrrr(
Titre: Re : Vos montures en photos
Posté par: fabien le 05 août 2005 à 08:55:40

Clochette a écrit:

fabien a écrit:
pour la 400 ... j'ai la flemme ... voir mon site :)

ok mais il ne fonctionne pas....!!! :confused:

maintenant il marche et y a plein d'autres photos
je pense que le probleme venait de chez free
Titre: Re : Vos montures en photos
Posté par: fabien le 05 août 2005 à 08:57:12

Toutoune a écrit:
Elle est super belle, mais le "titi" fait un peu desordre .....

c'est pas moi qu'il l'ai fait , mais le proprio précédent.
ce me gene pas,
on la reconnait, et puis quand je suis dessus, dans la bulle, dans l'ambiance course ... je le vois pas le titi
Titre: Re : Vos montures en photos
Posté par: fabien le 05 août 2005 à 08:59:04

nuts a écrit:
dit pourquoi tu met ta brel sur le site :confused:  alors qu'on sait meme pas qui tu est  :roll:  genre:

salut moi c'est ANONYME et voila LA MIENNE  :-o

alors moi c'est fabien ou fab le motard
je me suis présenté là  :

les photos de mes motos ... c'est pour continuer la présentation ...
Titre: Re : Vos montures en photos
Posté par: fabien le 05 août 2005 à 09:07:50
et la petite Z 400 :

Titre: Re : Vos montures en photos
Posté par: Hurl le 05 août 2005 à 11:02:17
Oulaaaa :-o
Fabien, tu peux éviter les posts à  répétition stp ? Merci. ;-)

Et puis pour le message de nuts, ca te concernait pas en fait.
Il parlait d'un post plus vieux, o๠le nom du compte a été remplacé par "anonyme"

PS: ta Z400 est vachement propre dis donc
Titre: Re : Vos montures en photos
Posté par: fabien le 05 août 2005 à 11:58:46

Hurl a écrit:
Oulaaaa :-o
Fabien, tu peux éviter les posts à  répétition stp ? Merci. ;-)

ok désolé ... et y a pas de bouton editer ou supprimer ??

PS: ta Z400 est vachement propre dis donc

je l'ai prise en photo un jour apres l'avoir bien lavée
mais sinon oui elle plutot en bon état ethetiquement, y a bien sur quelques trucs, mais pour son age ...
Titre: Re : Vos montures en photos
Posté par: Clochette le 05 août 2005 à 12:25:43

fabien a écrit:

ok désolé ... et y a pas de bouton editer ou supprimer ??

si si y a un bouton editer ;-)
Titre: Re : Vos montures en photos
Posté par: jolop le 05 août 2005 à 18:03:36

mieux tard que jamais :lol:
Titre: Re : Vos montures en photos
Posté par: Franck le 06 août 2005 à 00:36:14
Petite moto mais grosses photos, alors en pièces jointes, c'est mieux !
Titre: Re : Vos montures en photos
Posté par: chewie le 06 août 2005 à 20:48:53
allez, a mon tour...


Titre: Re : Vos montures en photos
Posté par: Globull le 06 août 2005 à 21:13:51
:love: ouahou, elle en jette la speed turtle :-) :D
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 07 août 2005 à 22:23:52
Elle est jolie, mais on dirait quand même qu'il lui en manque un bout a l'arriere... c'est fait expres pour pas prendre de passager?
Titre: Re : Vos montures en photos
Posté par: lolote le 07 août 2005 à 22:48:10
ben ca c est la mienne  :D  :D  :D


ben quoi lé zouli !!!

 :out:  :out:
Titre: Re : Vos montures en photos
Posté par: chewie le 08 août 2005 à 02:27:04

Ptitducky a écrit:
Elle est jolie, mais on dirait quand même qu'il lui en manque un bout a l'arriere... c'est fait expres pour pas prendre de passager?

nan, c'est pour que la passagere se tienne bien pres du pilote... tres tres pres  :D  :lol:

@lolote: marche po ton truc, recommence... :-P
Titre: Re : Vos montures en photos
Posté par: Globull le 08 août 2005 à 21:59:17

chewie a écrit:

@lolote: marche po ton truc, recommence... :-P

elle est corse, il faut l'excuser tu sais ...

Titre: Re : Vos montures en photos
Posté par: Aimé Caporale le 20 août 2005 à 14:51:44
Je me suis brièvement présenté , voila maintenant mon faucon, Hayabusa 1999 Full! qui vient après une....Hayabusa 2003 Full.

Quelques modifs : Biellettes de basculeurs modifiées (+2,5cm a l'arr.), reposes pieds alu GSXR, bulle noire zero gravity, selle retaillée, passage de roue et leche roue ermax.
A venir : qq accessoires carbone, durits aviation, disques wave
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 20 août 2005 à 14:57:39
Ca c'est un engin qui doit bien arracher les rétines....  :D
Titre: Re : Vos montures en photos
Posté par: Hurl le 23 août 2005 à 16:28:25

Busa99 a écrit:
Je me suis brièvement présenté , voila maintenant mon faucon, Hayabusa 1999 Full! qui vient après une....Hayabusa 2003 Full.

Toi t'a une buse
Et c'est moi qui posséde un faucon  :D
Titre: Re : Vos montures en photos
Posté par: ZedMed le 23 août 2005 à 21:00:34
Voici ma monture  :love:

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 23 août 2005 à 21:05:01
T'as fait péter un beau 4 en 1 Akra mon cochon!!!! j'avais le même sur mon ex Z-750 powaaaaaa!!!!!
 :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: ZedMed le 23 août 2005 à 23:05:57

Silent Phong a écrit:
T'as fait péter un beau 4 en 1 Akra mon cochon!!!! j'avais le même sur mon ex Z-750 powaaaaaa!!!!!
 :D  :D  :D

Merci Silent, maintenant elle respire comme il faut, et le son :love:  :love:  :love:
Kawa Powaaaaa!!!!!!
Titre: Re : Vos montures en photos
Posté par: le 24 août 2005 à 19:55:54

El_Dahu a écrit:
Petite moto mais grosses photos, alors en pièces jointes, c'est mieux !

Salut El_Dahu, J'aime beaucoup tes moto, le TDR c'est trops sympa à  conduire et la VFF aussi.. tu as une photo de ta 500??

Titre: Re : Vos montures en photos
Posté par: le 24 août 2005 à 22:27:17
Quelques une de mes tronconneuses:
Mon vibropalpeur:
( ca tiens pas la route sous la neige :roll: )

celle là  tiens pas la route sur le neige, ni sur le mouillé, en 5 ca patine rien que de regarder la poignée de droite :lol:  :

La premiere moto que j'ai réstauré:
Là  elle etait pas toute à  fait finie, depuis, je vous rassure, j'ai fait refaire la selle :D

mon sèche cheveux:
Enfin, là  elle est en cour de réstauration...:

Titre: Re : Vos montures en photos
Posté par: NeNe le 25 août 2005 à 20:54:40

cr491 a écrit:
celle là  tiens pas la route sur le neige, ni sur le mouillé, en 5 ca patine rien que de regarder la poignée de droite :lol:  :

l'attrape couillon par excellence, un 500 deguisé en 125'  :D  :D
Titre: Re : Vos montures en photos
Posté par: le 25 août 2005 à 21:24:17
Si il fait beau samedi, je la sors! :D

Titre: Re : Vos montures en photos
Posté par: le 26 août 2005 à 13:30:30
Ma belle:
Titre: Re : Vos montures en photos
Posté par: ChatNoir le 26 août 2005 à 22:15:09
Alors, voici des photos de mon SV et de la Bandit650 de Burbz :

( ( ( ( ( ( ( (
( ( ( ( ( ( ( (

Bon, les photos sont cadrées un peu à  l'arrache mais c'était en partant du taff.  :-)

Edit: suppresion des photos avec les plaques apparentes
Titre: Re : Vos montures en photos
Posté par: ChatNoir le 27 août 2005 à 09:16:45
Merci Sam     :shy:

J'ai toujours pas compris pourquoi les [img] ne passaient pas. C'est pas comme si j'étais un noub en forum  ^^
Titre: Re : Vos montures en photos
Posté par: brubz le 29 août 2005 à 08:26:31
jolies motos...
 :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: ChatNoir le 29 août 2005 à 09:01:32

brubz a écrit:
jolies motos...
 :D  :D  :D

Ouais, surtout la SV !

Titre: Re : Vos montures en photos
Posté par: africa42 le 29 août 2005 à 15:05:32
Voici les miennes :

( (


( (

Et la petite....
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 01 septembre 2005 à 23:13:31
voilà  la mienne :D

( (

( (
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 01 septembre 2005 à 23:14:36
arffffffff ça, marchait en previsualisation grrrrrrrrrrrrrrrrrrrrrrrrrrr :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 02 septembre 2005 à 09:48:15
Voili voilou, la mienne a mienne

( (

( (
Titre: Re : Vos montures en photos
Posté par: brubz le 06 septembre 2005 à 09:54:32
Voila le nouveau pot...
elle respire bcp mieux...

( (
Titre: Re : Vos montures en photos
Posté par: Blutch le 10 septembre 2005 à 18:57:58
Voici donc mon nouveau joujou développant la puissance phénoménale de ... 106 cv ... pas pour bien longtemps :roll:

( (
Quelle ne fut pas ma surprise lorsque je découvris ce fauve en cage :-o

( (
Heureusement, j'ai rapidement appris à  le dompter :-P

Vivement la prochaine arsou ... heu ... balade tranquille :D
Titre: Re : Vos montures en photos
Posté par: guillaume le 10 septembre 2005 à 19:11:53

Blutch a écrit:
Voici donc mon nouveau joujou développant la puissance phénoménale de ... 106 cv ... pas pour bien longtemps :roll:

( (
Quelle ne fut pas ma surprise lorsque je découvris ce fauve en cage :-o

( (
Heureusement, j'ai rapidement appris à  le dompter :-P

Vivement la prochaine arsou ... heu ... balade tranquille :D

C'est bà´, j'en suis tout retourné  :D
On dirait Cheeta sur la première photo  :lol:
Elle ne sera point pucelle bien longtemps, débridage Full Powaa après le rà´dage  :chine:

En tout cas çà  cause un 1000 Gex  :pouces:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 10 septembre 2005 à 19:18:25
J'espere pouvoir faire un jour la même tête :roll:  :D

Bon, ben c'est une zolie becane héhé :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 10 septembre 2005 à 19:57:16
Elle est superbe blutchie :pouces: tu vas te faire plaiz' mon cochon!!!  :D
Titre: Re : Vos montures en photos
Posté par: cardi le 10 septembre 2005 à 20:06:19

Silent Phong a écrit:
Elle est superbe blutchie :pouces: tu vas te faire plaiz' mon cochon!!!  :D

Titre: Re : Vos montures en photos
Posté par: Sam le 10 septembre 2005 à 20:31:43
J'adore les photos Blutch ;-) re-féloches !
Titre: Re : Vos montures en photos
Posté par: VFR01 le 10 septembre 2005 à 21:24:57
mdr les toph :lol:  :lol:  :lol: et jolie ton jouet :-o  :love:  :love:
Titre: Re : Vos montures en photos
Posté par: Tonyo le 10 septembre 2005 à 23:20:04
PTDR Blutch...
Have fun, j'espère qu'on pourra la voir rapidement...

@Eldarin : Depuis quand t'as ça toi ???????????  :confused:
Titre: Re : Vos montures en photos
Posté par: hagaryo le 11 septembre 2005 à 10:57:52
Beurk j'aime pas du tout cette brèle moi!!! je la trouve moche et je suis sûr qu'elle vaut rien en plus !!!
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 11 septembre 2005 à 11:54:59
qq une de la mienne vite fait...........;

( (

( (

( (


premiere impression de conduite:

un velo !! apparement pas mal de chevaux mais rodage oblige !!

a pluche
Titre: Re : Vos montures en photos
Posté par: Guillaume le 11 septembre 2005 à 12:03:27
cool la 636 k5, j'avais bien aimé quand je l'avais essayée  :-)
par contre ça me faisait un truc bizarre: je voyais le compteur à  travers la bulle :confused: ... pas très pratique
Titre: Re : Vos montures en photos
Posté par: Hurl le 12 septembre 2005 à 13:12:03
Jolies montures, félicatations ;-)
Titre: Re : Vos montures en photos
Posté par: Franck le 12 septembre 2005 à 18:13:00
hop apres les presentations , vala la motobylette toute new...

Donc quelques pièces commandées en attente....

( (

( (

Du coup , j'en profite pour dire ke j'ai un ZX9R à  vendre ... ;-)
Titre: Re : Vos montures en photos
Posté par: VFR01 le 12 septembre 2005 à 19:02:57
:love:  :love:  :love:  :love: trop beau ton 10R surtout le bleu j'adore
Titre: Re : Vos montures en photos
Posté par: Franck le 12 septembre 2005 à 19:57:49
le 9R est bleu aussi .........

T'achétes ....!   Mdrr     :lol:  8-)
Titre: Re : Vos montures en photos
Posté par: VFR01 le 12 septembre 2005 à 19:59:00

Litteul_Kevin a écrit:
le 9R est bleu aussi .........

T'achétes ....!   Mdrr     :lol:  8-)

t'as une photo :confused:
Titre: Re : Vos montures en photos
Posté par: Franck le 12 septembre 2005 à 20:04:58
tant ke j'y suis , des tofs du 9R allez hop ......

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: VFR01 le 12 septembre 2005 à 20:07:06
jolie en effet, j'aime bien l'effet sur la dernière photo ;-)
Titre: Re : Vos montures en photos
Posté par: Franck le 12 septembre 2005 à 20:10:30
oué  , ca fait de suite la différence ....

Big-argument commercial koi ..... :lol:  8-)
Titre: Re : Vos montures en photos
Posté par: eldarin le 13 septembre 2005 à 17:24:23
Moi c'est l'hayabusa qui me fait craquer  :-)
Titre: Re : Vos montures en photos
Posté par: Globull le 13 septembre 2005 à 17:28:13

eldarin a écrit:
Moi c'est l'hayabusa qui me fait craquer  :-)

ça y est, tu va rechanger ??? :D :-P
Titre: Re : Vos montures en photos
Posté par: eldarin le 13 septembre 2005 à 17:34:48
Nan, vé po changer, cela reste un avis c'est tout .

Seulement, si elle devenai lors d'un restylisage, d'ici 2 3 ans un peu plus GT, alors.... :-)

Las mon but, c'est de me faire plaise pendant au moins 2 ans avec la triumph, avec un poil de circuit !  :-)
Titre: Re : Vos montures en photos
Posté par: Globull le 13 septembre 2005 à 17:51:28

eldarin a écrit:
Nan, vé po changer, cela reste un avis c'est tout .

Seulement, si elle devenai lors d'un restylisage, d'ici 2 3 ans un peu plus GT, alors.... :-)

Las mon but, c'est de me faire plaise pendant au moins 2 ans avec la triumph, avec un poil de circuit !  :-)

sage decision ;-) :-)

et je susi totu a fait d'accord avec toi a propos du dessin de la busa  ! :-)
Titre: Re : Vos montures en photos
Posté par: Guest le 22 septembre 2005 à 11:18:01

Ca c'est ma Miss ZZzz a moi  :-P  :-P
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 22 septembre 2005 à 11:23:18

grizzzlyyy a écrit:

Ca c'est ma Miss ZZzz a moi  :-P  :-P

bah o๠ça???  :confused:  hihihi!
Titre: Re : Vos montures en photos
Posté par: adrien le 22 septembre 2005 à 11:28:13

Silent Phong a écrit:

grizzzlyyy a écrit:

Ca c'est ma Miss ZZzz a moi  :-P  :-P

bah o๠ça???  :confused:  hihihi!

elle a été sencuré lol quel belle croix
Titre: Re : Vos montures en photos
Posté par: Guest le 22 septembre 2005 à 11:31:27

Silent Phong a écrit:

bah o๠ça???  :confused:  hihihi!

Mais là : file:///D:/Mes%20documents/ALBUM/moto

Ca ce voit pas?  :D
Titre: Re : Vos montures en photos
Posté par: Globull le 22 septembre 2005 à 11:40:39

'tin le_lapin va falloir calmer tes ardeurs ... :roll: on pourri pas le topic des motos :cry: !!!!
Titre: Re : Vos montures en photos
Posté par: Franck le 22 octobre 2005 à 12:44:37
Bon bé je va me la jouer partisan du moindre effort et vous filer les liens qui renvoient sur mon diaporama perso...

Ma mob' (

Ma relique (
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 22 octobre 2005 à 14:39:58
yess tip top ta 500 Four ! vraiment belle :pouces:  :pouces:  :pouces:
Titre: Re : Vos montures en photos
Posté par: NeNe le 22 octobre 2005 à 19:27:11
( (   ( (
Titre: Re : Vos montures en photos
Posté par: guillaume le 22 octobre 2005 à 19:30:05
Joli mon Néné! Une de plus à  ton palmares! ;-)
Titre: Re : Vos montures en photos
Posté par: Sam le 22 octobre 2005 à 19:34:21

NeNe a écrit:
( (   ( (
t'as encore changé de moto NéNé !
Féloches pour l'acquisition ;-)
Titre: Re : Vos montures en photos
Posté par: NeNe le 22 octobre 2005 à 21:23:42
gex 2001, 40000km - contre - Z1000 2003, 10000km

rajout 325€ avec la carte grise, payé 6500€ cà´te 7400€... c'est ce qu'on appele une affaire a ne pas trop refuser  ;-)  mici Guillaume et Sam  :-)
Titre: Re : Vos montures en photos
Posté par: Globull le 23 octobre 2005 à 00:18:34
bé mon ptit néné t'es encore fait plaiz' à  ce que je vois :-) c'est beau bravo, feloch' pour l'acquisition :-)
Titre: Re : Vos montures en photos
Posté par: VFR01 le 23 octobre 2005 à 09:07:10
Néné le roi de la bonne affaire  ;-) en tout magnifique z1000 :love:
Titre: Re : Vos montures en photos
Posté par: africa42 le 23 octobre 2005 à 10:16:35
félicitation néné, fais gaffe a pas la mettre dans les arbres  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Psychose le 24 octobre 2005 à 16:34:01
Moi qui croyais être le seul Svs rouge, snif.. :upset:


Donc voila c'est ma première moto. Et je l'aime bcp  :D .

A la base je devais acheter une Svs bleu, mais le tps que je réunisse de l'argent, ba la vendeuse allait mieux financièrement et décida donc de ne plus la vendre... sans me décourager je regarde les annonces, je vois le modèle rouge (je savais même pas qu'il existait) je contact le vendeur.. rien que la vue du pot ma fait dire oui  :D  et voili.
Now je fais la star en suivant des grosses Ducati dans la monté de Lamastre.. eheheh 8-)

Comment ça les commentaires sont pas obligatoires? ba lé cool ma    life qd même non? meu si meu si.

Tiens ça me fait penser que mon Tricycle qd j'étais tt petit il était rouge aussi.. mdr est-ce un hasard? je ne sais.. il avait pas de pot Devil en tt cas c'est sur.

Edit: y a le texte qui part en cachnauète la à  coté de la photo ..  :mad:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 24 octobre 2005 à 18:22:33
En tout cas, ta roue arriere a l'air solidement attachée à  un point  :D
Titre: Re : Vos montures en photos
Posté par: Psychose le 24 octobre 2005 à 22:32:38
Mdr je pensais bien que qqlun ferait la remarque.. oui en même tps c'est dans mon jardin.. d'ailleurs, oui ça sert à  rien ;)
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 31 octobre 2005 à 18:43:31
Voila ma titine depuis un mois, et je lui ai mis dans les 2500 bornes (j'avais des sorties a rattraper...)

( (

Vous avez vu comme elle brille  8-)
Titre: Re : Vos montures en photos
Posté par: le 04 novembre 2005 à 17:15:10
Au risque de me faire traiter de kéké, voilà  ma tomo avec les néons qui vont bien ;)

La bête à  bientà´t 4 ans d'à¢ge, pot MIG full barrouf, passage de roue top-line, garde boue ermax, bulle aéromax jaune fluo, clignos oeil de chat, durites avia, tampons de protection, cable électroluminescent, jantes polies, plaque homologuée pour cause de PV  :D


La bête en détail (
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 04 novembre 2005 à 18:27:28
AAAHHHH mes suis aveugle....hihihih ( je rigole.... :D )
Titre: Re : Vos montures en photos
Posté par: StephMaha le 05 novembre 2005 à 22:12:56
Voici quelques photos prises cet apres-midi ....
Qu'est-ce que je la kiffe, classique, mais j'adoooOOooore les Sushis ( :roll: )  :D

( (

( (

( (

Petit pot Devil Trophy Full Barouf, Bulle aeromax, durites avia, et bientà´t jantes et bras oscillant polis, et petits clignos "chat"!!!  :D
Titre: Re : Vos montures en photos
Posté par: adrien le 05 novembre 2005 à 23:14:28

StephMaha a écrit:

jantes et bras oscillant polis

bon courage a polire et a entretenire :D

belgome alu powwwaaaa
Titre: Re : Vos montures en photos
Posté par: Frédéric le 16 novembre 2005 à 17:08:11
Voila la mienne, je vous listerais prochainement le travail effectué si j'ai le courage.


Ptite bouille


Ptit cul

Good VIiiIIIIIIIiIIiiiiibes
Titre: Re : Vos montures en photos
Posté par: Sam le 16 novembre 2005 à 17:27:24
Sympa ton mostro !

alors t'as fait quoi dessus ? :D
Titre: Re : Vos montures en photos
Posté par: Audrey le 16 novembre 2005 à 18:41:45
:hello: Coucou !

Moi je ne sais pas encore ; mon coeur balance entre le ER-6f et la B-King 600 ( peut-être un peu trop masculine !? )

Qu'en pensez-vous pour une première moto ? Allez ! J'ai besoin de conseils de connaisseurs !  :D




Vous me direz, le temps que j'obtienne mon permis, d'autres modèles seront sortis ?!  :lol:   Sans rire, j'espère enfin y arriver le printemps prochain.   :upset:
Titre: Re : Vos montures en photos
Posté par: StephMaha le 16 novembre 2005 à 18:56:00
Moi ca fait un moment que j'y pense pour GoMar, et je voulais aller tester la ER-6, elle a l'air pas mal du tout pour commencer cette p'tite  :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 16 novembre 2005 à 18:59:15
Preference pour la B-king  :-)
Titre: Re : Vos montures en photos
Posté par: Nicolas le 16 novembre 2005 à 19:02:59
Franchement la er6, elle est pas mal (mis à  part le pot), que ce soit en n ou en f !
Titre: Re : Vos montures en photos
Posté par: fabien le 16 novembre 2005 à 19:27:00

c'est ma fifille !!!
Titre: Re : Vos montures en photos
Posté par: Didier le 16 novembre 2005 à 23:28:48

M - In Ducati Veritas  :-P
Titre: Re : Vos montures en photos
Posté par: Cyriack le 15 décembre 2005 à 02:29:44
voila mon petit hornet :o)(
Titre: Re : Vos montures en photos
Posté par: Hurl le 15 décembre 2005 à 09:59:35
Magnifique :lol:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 15 décembre 2005 à 10:41:19
p'tain!!!!!!! trop d'la boule man!!!!! :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: eldarin le 15 décembre 2005 à 11:39:01
Tu passe inapercu avec  !!!  :D
Titre: Re : Vos montures en photos
Posté par: le 15 décembre 2005 à 12:20:40
C'est le premier hornet furtif. Model unique. :-P
Titre: Re : Vos montures en photos
Posté par: Globull le 15 décembre 2005 à 12:36:54
j'adore il est top discret mais hyper efficace :D :lol:
Titre: Re : Vos montures en photos
Posté par: Cyriack le 15 décembre 2005 à 13:43:42
c'est vrai qu'il est pas furtif... La police en sait quelque chose!
mais bon moi je l'ai bien......
Titre: Re : Vos montures en photos
Posté par: le 15 décembre 2005 à 13:52:49

senko a écrit:
c'est vrai qu'il est pas furtif... La police en sait quelque chose!
mais bon moi je l'ai bien......

On te crois, mais t'a pas oublié quelque chose? :D
Titre: Re : Vos montures en photos
Posté par: Cyriack le 15 décembre 2005 à 14:51:44
mot mystére: "aime bien" merci mayrton pour ton attention! :D  :D
Titre: Re : Vos montures en photos
Posté par: Globull le 15 décembre 2005 à 15:28:07

senko a écrit:
mot mystére: "aime bien" merci mayrton pour ton attention! :D  :D

non non en fait il voulais parler du post ou tu etais sensé nous presenter ton beau hornet ;-) :-)

t'as pas l'impression qu'il manque qlqch ? :-o :lol:

PS: tu serait pas blonde sous tes cheveux brun toi ?! :D :D :D
Titre: Re : Vos montures en photos
Posté par: Hurl le 15 décembre 2005 à 15:33:26
N'empeche, les 4 cylindres, je les preferes comme ceux de senko :lol:

J'ai compris !
Il a mis le lien de l'image sur son pc (c:\documents and settings ...)
Donc y'a que senko qui la voit, si ca marche chez lui, c'est pas sûr ca encore

Allé senko, va lire le topic sur comment mettre des photos ;-)
Titre: Re : Vos montures en photos
Posté par: Globull le 15 décembre 2005 à 15:34:45

Hurl a écrit:
N'empeche, les 4 cylindres, je les preferes comme ceux de senko :lol:

oui je suis d'accord, ... totalement ... ABSENT :D :lol2:

Ps: ROTFL !!!

désolé si je me fou de toi senko mouahahah mais mettre le lien vers l'image direct sur ton PC, a moins que tu ais une unité serveur o๠est stocké l'image en question :-Pet ben c'est grave queue memeuh

Si tu as effectivement un serveur, il chie a mort :-P ou alors tu t'y prend mal :-P :D
Titre: Re : Vos montures en photos
Posté par: le 15 décembre 2005 à 16:31:33

Globull a écrit:

senko a écrit:
mot mystére: "aime bien" merci mayrton pour ton attention! :D  :D

non non en fait il voulais parler du post ou tu etais sensé nous presenter ton beau hornet ;-) :-)

t'as pas l'impression qu'il manque qlqch ? :-o :lol:

PS: tu serait pas blonde sous tes cheveux brun toi ?! :D :D :D

Je suis mort de rire. T'as raison globull il n'a toujours pas vu. :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Cyriack le 15 décembre 2005 à 18:59:22
Bon ,je suis pas fortiche sur ces choses la...nouvel essai![img][img]
Titre: Re : Vos montures en photos
Posté par: Cyriack le 15 décembre 2005 à 19:00:08 sors
Titre: Re : Vos montures en photos
Posté par: no69 le 15 décembre 2005 à 19:01:15
ca marche po mdr :D
Titre: Re : Vos montures en photos
Posté par: StephMaha le 15 décembre 2005 à 19:03:19
il manque juste un / dans le dernier tag [/img]  :-P  Encore un effort t'y es presque  :D
Titre: Re : Vos montures en photos
Posté par: Cyriack le 15 décembre 2005 à 19:08:21
ah oui merci!(
Titre: Re : Vos montures en photos
Posté par: no69 le 15 décembre 2005 à 19:10:41
bravo!!!!! :01:  :yeah:  :pint:
Titre: Re : Vos montures en photos
Posté par: Sam le 15 décembre 2005 à 19:22:29

senko a écrit:
ah oui merci!

en effet... furtif le Hornet :D
Titre: Re : Vos montures en photos
Posté par: Globull le 15 décembre 2005 à 19:27:55
clap clap clap

effectivement il passe moins inapperçu :D
Titre: Re : Vos montures en photos
Posté par: VFR01 le 15 décembre 2005 à 19:34:10

Globull a écrit:
clap clap clap

effectivement il passe moins inapperçu :D

tu m'etonnes  :D
Titre: Re : Vos montures en photos
Posté par: NeNe le 15 décembre 2005 à 21:40:34

senko a écrit:
ah oui merci!


je le trouve superbe  ;-)
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 15 décembre 2005 à 21:47:04

NeNe a écrit:

senko a écrit:
ah oui merci!


je le trouve superbe  ;-)

chacun ses gouts!!  :D  :lol:  :-P
Titre: Re : Vos montures en photos
Posté par: NeNe le 15 décembre 2005 à 21:50:10

Sylv1 a écrit:
chacun ses gouts!!  :D  :lol:  :-P

 :D  :D  :D salo  :-P
Titre: Re : Vos montures en photos
Posté par: darkangel le 16 décembre 2005 à 00:29:27
mouais c est un hornet quoi..... :embarras:
Titre: Re : Vos montures en photos
Posté par: bro7 le 16 décembre 2005 à 09:43:29
Mouais, il est bien sympathique!!  :-)  :pouces:
 Mais pas tres furtif!! :D
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 16 décembre 2005 à 10:41:28
ben original le frelon  :pouces:
Titre: Re : Vos montures en photos
Posté par: hagaryo le 18 décembre 2005 à 15:57:33

La mienne  :-)
Titre: Re : Vos montures en photos
Posté par: Globull le 18 décembre 2005 à 18:15:51
très très lovely :love: hagaryo ! :-) :pouces:
Titre: Re : Vos montures en photos
Posté par: Blutch le 19 décembre 2005 à 00:24:19
Hagaryo, que c'est beau :pouces:
Avec le silencieux yosh, on dirait vraiment une brèle de course ! Vivement la semaine prochaine que je reçoive le mien ;-) (et encore merci pour le tuyau :D)
Tes liserets sur les contours des jantes, tu les as acheté o๠? Moi aussi je voulais en mettre, mais en rouge (comme le [color=FF0000]R[/color][/b] de GSX-R). Comme ça on aura pas tout à  fait les même motos :lol:
Titre: Re : Vos montures en photos
Posté par: eldarin le 19 décembre 2005 à 01:21:42
Une bien belle machine en effet  :-)
Titre: Re : Vos montures en photos
Posté par: VFR01 le 19 décembre 2005 à 08:36:40
superbe Hagaryo  :-)
Titre: Re : Vos montures en photos
Posté par: hagaryo le 19 décembre 2005 à 17:26:40
Merci pour elle  :-)   pour les liserets j'ai été chez feu vert.
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 19 décembre 2005 à 18:31:06
Ce Gex1000 K5, j'en rêve la nuit :love: ..... en Black bien sûr!!!  :D
Titre: Re : Vos montures en photos
Posté par: NeNe le 19 décembre 2005 à 19:58:09

Silent Phong a écrit:
Ce Gex1000 K5, j'en rêve la nuit :love: ..... en Black bien sûr!!!  :D

copiteur  :-P

mais c'est vrai.. que... elle est sublime  :-)
Titre: Re : Vos montures en photos
Posté par: Nicolas le 29 décembre 2005 à 11:36:55
Here's mine ...

( (

Titre: Re : Vos montures en photos
Posté par: Guest le 29 décembre 2005 à 12:12:15

apres quelques difficultés pour mettre mon bebe la voici enfinnnnnn comme dans la vie faut jamais deseperé

merci a toi edlapoignée et a toi aussi BadStouph

voili sileng phong tu vas voir mon tresor
Titre: Re : Vos montures en photos
Posté par: Hurl le 29 décembre 2005 à 12:52:17
Sympa bien que j'ai du mal avec le jaune (enfin jsute pour la couleur des motos :lol:)


ptitemotarde a écrit:
voili sileng phong tu vas voir mon tresor

Je crois qu'il s'attendait a voir autre chose ... :lol: :lol: :lol:
Ok ok :out:
Titre: Re : Vos montures en photos
Posté par: le 29 décembre 2005 à 12:58:40
alors c'est mon tour lol

voila mon fidel destrier

Titre: Re : Vos montures en photos
Posté par: supersport le 29 décembre 2005 à 13:29:25
Titre: Re : Vos montures en photos
Posté par: Guest le 29 décembre 2005 à 21:27:13
desole mais mon autre tresor jle montre pas à  nimporte qui faut etre tres sage lol

je plaisante bien sur
Titre: Re : Vos montures en photos
Posté par: Psychose le 29 décembre 2005 à 21:41:19
Sympa tt ça.


ptitemotarde a écrit:
desole mais mon autre tresor jle montre pas à  nimporte qui faut etre tres sage lol

je plaisante bien sur

mdr ;)
Titre: Re : Vos montures en photos
Posté par: Pascal le 29 décembre 2005 à 22:19:39
vla ma nouvelle bestiole
je vous fais grace du fond, c'est un local poubelle pour cause de neige, je vous en mettrais d'autres....ouai.
( (
( (

j'espere que ca va suis nul au jeu des images.

elle est beeeeeeeelle hiiiiiiiiiin?
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 29 décembre 2005 à 22:35:34
ouais....on a gagné un

hihihi en tt cas sa a l'air tres joueur tt ca....vivement la fin du rodage:lol:

par contre, qu'est ce que c'est que ce fond rouge???c'est po bo ca... :D
Titre: Re : Vos montures en photos
Posté par: Pascal le 29 décembre 2005 à 22:45:57
bon hem on essaye une deuxieme?????
Titre: Re : Vos montures en photos
Posté par: Pascal le 29 décembre 2005 à 23:29:28
a la demande de ptiducky:

( (

et hop avec les zoreilles de mickey pour que tout le monde se foute de moi!!

( (
ca va ca va y fait froid hin
je sais c'est moche

Edit: correction des liens
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 29 décembre 2005 à 23:40:42
bon on voie po tres bien sur tes timbres poste... :D mais mosieur...a mis des manchons comme sur les scooters pour ne po avoir froid a ces petits :lol:
Titre: Re : Vos montures en photos
Posté par: Pascal le 29 décembre 2005 à 23:42:45
j'ai des pti doigts sensibles moi
et pis des oreilles demickey c'est cool pour l'hiver
Titre: Re : Vos montures en photos
Posté par: Hurl le 30 décembre 2005 à 00:08:07
Moooossieur s'est fait plaisir à  ce que je vois ! :D

Je la trouve bien sympa en tout cas !
Sauf la grosse bavette et les rétro, mais ca se change facilement ca.

Et sinon niveau taille ca va mieux ?
Enfin vivement qu'il fasse meilleur pour que tu puisses rouler avec correctement.
Parce que ca surement la neige ou meme route glissante, c'est meme pas la peine ! :-)
Titre: Re : Vos montures en photos
Posté par: supersport le 30 décembre 2005 à 06:40:34
superbe ta nouvelle bécane :-)
Titre: Re : Vos montures en photos
Posté par: greg le 07 janvier 2006 à 17:19:27
voici ma monture

( (
Titre: Re : Vos montures en photos
Posté par: Psychose le 07 janvier 2006 à 18:38:05
Stop flood Greg, y a d'autres moyens pour faire monter tes posts mdr
Titre: Re : Vos montures en photos
Posté par: StephMaha le 07 janvier 2006 à 19:04:42

Psychose a écrit:
Stop flood Greg, y a d'autres moyens pour faire monter tes posts mdr

T'en sais quelque chose, hein "Héhé" Man ....  ;-)
Titre: Re : Vos montures en photos
Posté par: greg le 07 janvier 2006 à 20:06:04

Psychose a écrit:
Stop flood Greg, y a d'autres moyens pour faire monter tes posts mdr

t inquiete  c est pas pour ca  pas evident de mettre une photo tout le monde n est pas doué en informatique lol
Titre: Re : Vos montures en photos
Posté par: guillaume le 15 janvier 2006 à 21:31:51
Voici ma nouvelle bête  8-)

Titre: Re : Vos montures en photos
Posté par: eldarin le 16 janvier 2006 à 09:22:37
Et t'en es content?  :D
Titre: Re : Vos montures en photos
Posté par: frédéric fasolino le 16 janvier 2006 à 20:13:52
quézako ???
Titre: Re : Vos montures en photos
Posté par: adrien le 16 janvier 2006 à 21:10:24

lestouil a écrit:
quézako ???

un gode a roue   :lol:

un pocket bicke garçon
Titre: Re : Vos montures en photos
Posté par: eldarin le 17 janvier 2006 à 11:18:20

lestouil a écrit:
quézako ???

 :lol:  :lol:  :lol:  :lol:  :lol:  :D  :D  :D  :D  :D  :D  :lol:  :lol:  :lol:  :lol:  :lol:  :-P  :-P  :-P  :-P
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 17 janvier 2006 à 11:22:20
Ouéééééééééééé poto Guile!!!!!!!!!!!! :pouces:
avec ça, tu vas le poser ce satané genou!!!!  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: guillaume le 17 janvier 2006 à 11:35:42
J'ai déjà  rà¢clé les cales pieds et les pompes, manque plus que genou comme tu dis Silent. Sinon j'en suis super content de ce pocket. Par contre çà  demande de la logistique (bidon, synthèse, SP95). C'est fun, parès faut rouler à  plusieurs poiur faire des petites courses. C'est un 49.9 cc, donc plus performants qu'un 47. Y'a pas de refroidissement liquide. Y'a un starter pour démarrer facilement.
Une fois lancé, çà  doit monté vers 50 à  60 km/h, y'a de bonnes sensations.
Titre: Re : Vos montures en photos
Posté par: Hurl le 17 janvier 2006 à 12:00:20
Ben si t'en es content, je me laisserais bien tenter ...
Tu peux nous rappeler le tarif d'une petite bete comme ca ?
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 17 janvier 2006 à 12:51:08

Hurl a écrit:
Ben si t'en es content, je me laisserais bien tenter ...
Tu peux nous rappeler le tarif d'une petite bete comme ca ?

One more bab' !!!!!!!!!

ça fait longtemps que ça me travaille aussi ce pocket!!!!

mais bon, vu l'usage, je pense que je vais tacher d'en trouver un d'occaz'  :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 17 janvier 2006 à 13:02:26

Silent Phong a écrit:

Hurl a écrit:
Ben si t'en es content, je me laisserais bien tenter ...
Tu peux nous rappeler le tarif d'une petite bete comme ca ?

One more bab' !!!!!!!!!

ça fait longtemps que ça me travaille aussi ce pocket!!!!

mais bon, vu l'usage, je pense que je vais tacher d'en trouver un d'occaz'  :D

Je me tenterai pas dans l'achat d'occase....  :-(
Titre: Re : Vos montures en photos
Posté par: frédéric fasolino le 17 janvier 2006 à 19:02:10

adrien a écrit:

lestouil a écrit:
quézako ???

un gode a roue   :lol:

un pocket bicke garçon

merci j'avais bien vu man  ;-)

just to joke
Titre: Re : Vos montures en photos
Posté par: eldarin le 17 janvier 2006 à 19:03:29

lestouil a écrit:

adrien a écrit:

lestouil a écrit:
quézako ???

un gode a roue   :lol:

un pocket bicke garçon

merci j'avais bien vu man  ;-)

just to joke


alors dans ce cas  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: frédéric fasolino le 17 janvier 2006 à 19:06:53
tu vois tu as ris 2 fois lol
Titre: Re : Vos montures en photos
Posté par: le 18 janvier 2006 à 09:29:58
Ca c'est du costaud...

Titre: Re : Vos montures en photos
Posté par: le 18 janvier 2006 à 09:32:39
Parmis d'autres j'ai eu celle ci aussi.
Titre: Re : Vos montures en photos
Posté par: Damien le 18 janvier 2006 à 19:48:42
Ca c'est mon bijoue a moi.

( (
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 18 janvier 2006 à 20:03:49

Bandito a écrit:
Ca c'est mon bijoue a moi.


ou ca y'a qu'une bandit ur la photo??..........


( (
Titre: Re : Vos montures en photos
Posté par: greg le 19 janvier 2006 à 13:28:26

greg a écrit:
voici ma monture

( (

Me voila sur le circuit d issoire(
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 19 janvier 2006 à 13:30:41
Y'a un mec qui va te faire l'exter' là  nan???  :D
Titre: Re : Vos montures en photos
Posté par: ZedMed le 19 janvier 2006 à 13:32:31

Silent Phong a écrit:
Y'a un mec qui va te faire l'exter' là  nan???  :D

On dirai un side. :D
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 19 janvier 2006 à 13:39:27

greg a écrit:

greg a écrit:
voici ma monture

( (

Me voila sur le circuit d issoire(

c'est quoi ce genou tout serrer !! mais tu va le faire frotter oui!!!

( (
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 19 janvier 2006 à 13:48:24

Sylv1 a écrit:
c'est quoi ce genou tout serrer !! mais tu va le faire frotter oui!!!

en même temps je vois pas de slid' sur son futal!!!  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Globull le 19 janvier 2006 à 17:24:26

Silent Phong a écrit:
Y'a un mec qui va te faire l'exter' là  nan???  :D

ila va lui faire ... il lui fait !!! :lol:

ça ressemble a un ZX en poly piste ... (si je suis pas trop mauvais :roll: ce qui est loin d'etre le cas donc je m'attend a ce qu'on me dise que c'est autre chose :D)
Titre: Re : Vos montures en photos
Posté par: greg le 19 janvier 2006 à 18:27:49

greg a écrit:

greg a écrit:
voici ma monture

( (

Me voila sur le circuit d issoire(

c' était le début de la journée a la fin je penchais beaucoup

plus et puis seulement deux mois de permi et j était déja sur

la piste alors meme si il m a doublé s est pas grave la

prochaine fois je l ' aurai lol

et pour les slide s est pour bientot et peut etre les faire frotter

sur le circuit de bresse
Titre: Re : Vos montures en photos
Posté par: Didier B le 20 janvier 2006 à 18:50:55
Bon, alors..

Voici la mienne...

Avant (

Après (

oui, entre temps, elle a eu un ptit souci de circuit, mais c'était pas moi le pilote...j'avais une doublure ce jour là   :roll:  ;-)

En suite, voici celle de madame..
Avec Madame dessus..c'te classe ( :lol:

ET bientot, elle sera comme ça, la mienne...
quand j'aurai refait la peinture..
Titre: Re : Vos montures en photos
Posté par: Hurl le 20 janvier 2006 à 19:16:40
J'espere que y'a pas eu trop de mal pour ta chute.
M'enfin dommage que ce soit une jap, une yam et un 4 cylindre ...
Titre: Re : Vos montures en photos
Posté par: Didier B le 20 janvier 2006 à 19:21:17
Pfff :lol:
Un jour je serai grand, j'aurai une 749  :embarras:  8-)
Titre: Re : Vos montures en photos
Posté par: Hurl le 20 janvier 2006 à 19:24:02
Bon ca va, tu es pardonné :-)
Titre: Re : Vos montures en photos
Posté par: eldarin le 20 janvier 2006 à 19:42:01

Bob a écrit:
Pfff :lol:
Un jour je serai grand, j'aurai une 749  :embarras:  8-)

Nannnnnnnn!!! Un jour tu seras plus grand tu aura un 3 pattes!

Triumph powa!!!  :D

Encore, t'aurai dit 999.....  :D

Sinon, bien sympas ses breles  :-)
Titre: Re : Vos montures en photos
Posté par: Didier B le 20 janvier 2006 à 19:43:01
non, ça ira..j'ai déjà  une Anglaise en automobile, avec 8 pattes en V...m'en mort encore les doigts.. :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: eldarin le 20 janvier 2006 à 19:46:12

Bob a écrit:
non, ça ira..j'ai déjà  une Anglaise en automobile, avec 8 pattes en V...m'en mort encore les doigts.. :lol:  :lol:

Moi ma caisse une 4 pattes en allemand et diesel powa! , je m'en mord pas du tout les doigts!

Alors ecoute tonton darin, 3 pattes !!!!!!!!!!!!!!!  :D
Titre: Re : Vos montures en photos
Posté par: Psychose le 20 janvier 2006 à 19:56:03
Joli, sauf celle avec le broutage de gazon  :-P
Titre: Re : Vos montures en photos
Posté par: greg le 20 janvier 2006 à 20:28:02
Pas mal moi a issoire j ai fait une sortie j ai fini dans l herbe

mais pas tombé !!!!!!!!!!!!!!!
Titre: Re : Vos montures en photos
Posté par: Didier B le 20 janvier 2006 à 20:40:41
ha ben je vois que t'as reconnu le paysage  :lol:

ouai, enfin là , c'est un cas particulier...pas tombé, mais poussé...enfin percuté lamentablement par un débutant et une faute de traj.
C'est moi qui prenait les photos  :lol:

J'voulais la voir prendre de l'angle..j'en demandais pas tant  :roll:
Titre: Re : Vos montures en photos
Posté par: Sam le 20 janvier 2006 à 20:49:24
belle bête, le Cat

un moment c'est ce que je voulais... heureusement j'ai ouvert les yeux :D :-P Vive le bi hihi
Titre: Re : Vos montures en photos
Posté par: Didier B le 21 janvier 2006 à 09:38:24

Je vois ce que tu veux dire... :-P

Si tu regardes ce que j'ai eu comme brèle...imagine ma douleur quand j'ai du passer sur un ptit 600...
je l'avais acheté car on ne pouvait plus avoir 2 motos, et c'était la seul que ma chérie voulait conduire, alors je l'ai acheté au début pour nous 2.
Puis,avec le temps, les sorties, l'apprentissage, j'y trouvé que du bien dedans son ptit moteur bien creux.
Puis, un passage en pignon de 14 pour gagner un peu "en bas"...

Maintenant, j'aime bien, même si j'ai une conduite plus proche d'un bi ou d'une 1000. Car j'ai du mal à  faire miauler le chaton, ça me fait mal aux dents.  :cry:

La seule fois ou je l'ai fait hurler, c'était lors du stage Sarron, et j'étais bien content d'avoir si peu de couple à  la remise des gaz en sortie de courbe quand j'ai vu tous les Bi ou autre gros cube se mettre au tat à  cause d'accélération trop optimiste  :-P

Mais c'est vrai qu'elle manque de peps en bas (et encore,car elle reste la plus coupleuse des "vieux 600", et la plus GT aussi des sportive de l'époque), car en haut, ça va plutot bien et c'est pas un endroit ou je vais souvent.

D'ailleurs, j'ai beaucoup de mal avec les "nouvelles" motos d'aujourd'hui. quand on prend le nouveau R6 et ses 18000 tours à  se demander à  quoi ça sert  :roll:
Certes, elle est magnifique...Mais pour le quotidien, je reste septique..

Donc, pour en revenir aux moutons, le BI est un très très bon choix, et il doit être dificile de revenir sur 1 quattre pattes après ça.
mais on s'habitue à  tout avec le temps... 8-)
C'est pas en 20 min d'essais de Cap Moto qu'on se fait une idée d'un moteur ou d'une machine. ça d'ailleurs, c'est domage...ils devraient nous faire des prêts WE..
quoi  ? je rêve ?  :lol:
Titre: Re : Vos montures en photos
Posté par: Hurl le 21 janvier 2006 à 10:08:00

Bob a écrit:
quoi  ? je rêve ?  :lol:

Je crois ouais  :D
Mais si t'a trouvé un endroit o๠les reves deviennent réalité, tu me fais signe ok ?  ;-)
Titre: Re : Vos montures en photos
Posté par: eldarin le 21 janvier 2006 à 10:15:43

Sam a écrit:
belle bête, le Cat

un moment c'est ce que je voulais... heureusement j'ai ouvert les yeux :D :-P Vive le bi hihi

Ca me fait penser que j'ai eu une thunderace ! Superbe machine a faire des bornes, un poil lourde quand meme !

Titre: Re : Vos montures en photos
Posté par: Sam le 21 janvier 2006 à 13:23:43

Bob a écrit:
Donc, pour en revenir aux moutons, le BI est un très très bon choix, et il doit être dificile de revenir sur 1 quattre pattes après ça.
mais on s'habitue à  tout avec le temps... 8-)
oui il faut surement un temps d'adaptation.
Là  ça fait plus d'un an et demi que je roule avec le SV... je crois que je ne pourrais pas me faire à  une moto avec peu de frein moteur déjà .
Mais j'ai jamais conduit de 4 cylindres... je me demande ce que ça donne lol

enfin pour conclure, j'dis toujours "vive le bi" et "bouuuh les 4 cylindres", mais c'est surtout pour rigoler.
On a chacun nos préférences et un type de conduite qui se prête mieux à  tel ou tel type de moto.

n'empêche que c'est mieux les bi... :-P
Titre: Re : Vos montures en photos
Posté par: StephMaha le 21 janvier 2006 à 14:10:40

Sam a écrit:

Mais j'ai jamais conduit de 4 cylindres... je me demande ce que ça donne lol

Y a un proverbe qui dit, si mes souvenirs sont bons : "Quand on ne sait pas, ....."

 :lol:  :lol:  :-P
Titre: Re : Vos montures en photos
Posté par: Sam le 21 janvier 2006 à 14:15:36
ben prete moi ton R1 alors :D
Titre: Re : Vos montures en photos
Posté par: StephMaha le 21 janvier 2006 à 14:18:15
OK ...  :D

Meuh non, Sam, réveille toi, tu t'étais encore endormie sur ton clavier !!!  :lol:
Titre: Re : Vos montures en photos
Posté par: Sam le 21 janvier 2006 à 14:23:57
ah ben voila, tu veux que je reste ignorante alors... pour une fois que je faisais un effort... c'est pas sympa... :-P
Titre: Re : Vos montures en photos
Posté par: Didier B le 22 janvier 2006 à 10:28:42
@Sam : Pas de pb, je l'avais bien pris au 4ème degré  ;-)

@Hurl : tiens, ça me fait penser qu'hier, j'ai appelé honda à  CapMoto, car j'avais vu un magnifique CBR1000RR d'occase sur leur parking. me suis dit qu'enfin je pourrai peut être l'essayer.
Faut dire que ça fait 1 an et demi que je leur demande un essai  :-(
Ben non, encore rater..c'est un dépot vente soi-disant  :-(

Bref, je comprends que c'est pas un CBF600, mais quand même...aucune possibilité d'essai de cette brèle sur Lyon en 1 an et demi...

Mais j'ai bon espoir, les modèles 2004 (c'est celui la que je voudrais) vont commencer à  être repris par les conc pour de nouvelles ventes..donc je me dis qu'un jour je pourrai enfin l'essayer..20 min  :mad:  :roll:
Titre: Re : Vos montures en photos
Posté par: eldarin le 22 janvier 2006 à 12:50:13
Hurl, j'attend la RED MACHINE !!!!!!!  :-)
Titre: Re : Vos montures en photos
Posté par: le 22 janvier 2006 à 12:51:11
J'ai attaqué enfin la peinture de mon zzr .Prochainement des photos...

Titre: Re : Vos montures en photos
Posté par: Hurl le 22 janvier 2006 à 17:36:26

eldarin a écrit:
Hurl, j'attend la RED MACHINE !!!!!!!  :-)

Kékidilui ?  :confused:  :D

Va falloir etre passient parce que j'ai pas pu aujourd'hui et il fait déjà  nuit, et la semaine je finis trop tard.
Donc rdv le week end prochain ;-)
Titre: Re : Vos montures en photos
Posté par: Globull le 22 janvier 2006 à 17:50:45
déçuuuuu ... je suis déçuuuuu .....  :roll:

va falloir te faire pardonner hurl ! tu nous appate avec des promesse coloriomettrique, de la nouveauté a gogo et pis keunéni ! spa bien ça ! :D
Titre: Re : Vos montures en photos
Posté par: adrien le 22 janvier 2006 à 19:46:55
voila donc la premiere un super dr modifier par mes soins



ensuite apres j'ai eu un sv 1000s quon ma volé au boue de 5 mois dans mon garage  :upset:

l'actuelle gsxr powwwaaa


Titre: Re : Vos montures en photos
Posté par: Silent Phong le 23 janvier 2006 à 10:22:01

Bob a écrit:

Bref, je comprends que c'est pas un CBF600, mais quand même...aucune possibilité d'essai de cette brèle sur Lyon en 1 an et demi...

La CBR1000 RR j'ai pu l'essayer dès sa sortie chez Honda Limas-Villefranche sur Saone....

Appelles les pour voir s'ils ont encore leur modèle d'essai
Aumiot Motos: 04-74-65-19-79
Titre: Re : Vos montures en photos
Posté par: Sam le 23 janvier 2006 à 10:31:47

Bob a écrit:
@Hurl : tiens, ça me fait penser qu'hier, j'ai appelé honda à  CapMoto, car j'avais vu un magnifique CBR1000RR d'occase sur leur parking. me suis dit qu'enfin je pourrai peut être l'essayer.
Faut dire que ça fait 1 an et demi que je leur demande un essai  :-(
Ben non, encore rater..c'est un dépot vente soi-disant  :-(
ben c'est pas vraiment normal, même en dépot vente !!! on a le droit de pouvoir essayer une moto que l'on va potentiellement acheter...

Mdr, le SV c'est limite le concessionnaire qui m'a forcé à  l'essayer... :D
Titre: Re : Vos montures en photos
Posté par: Didier B le 23 janvier 2006 à 11:39:07
ouai, chez Suz, ils sont cools..
Enfin ça dépend ou, mais en général leur politique de vente est + sympa..à  tous niveau  8-)
Titre: Re : Vos montures en photos
Posté par: Blutch le 21 février 2006 à 14:55:38
Quelques photos de ma moto de compèt :embarras:
Reste plus qu'à  devenir un bon pilote :D

Titre: Re : Vos montures en photos
Posté par: Hurl le 21 février 2006 à 15:08:14
Sympatoche mais y'a un gars qui s'est amusé à  te coller des autocollants à  la con partout dis donc !! :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 22 février 2006 à 01:03:08

:yeah: z'avez vu les autocollants de la tête de fourche??? :yeah:
Titre: Re : Vos montures en photos
Posté par: StephMaha le 22 février 2006 à 01:15:38
Yep, c'est énorme.... :10: Blutch...
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 22 février 2006 à 01:21:02

StephMaha a écrit:
Yep, c'est énorme.... :10: Blutch...

:yeah: c'est noooooous :yeah::saut:hihihi!!!!
Titre: Re : Vos montures en photos
Posté par: Thomas ARMAND le 22 février 2006 à 14:57:09
Y a qui ce la pète bien sur le site !!! Hein, le père Blutch !!!

Va falloir assurer le pilotage maintenant  !!! Porter le numéro 1, c'est pas évident !!!

Titre: Re : Vos montures en photos
Posté par: Blutch le 23 février 2006 à 10:36:50

tom69 a écrit:
Va falloir assurer le pilotage maintenant  !!! Porter le numéro 1, c'est pas évident !!!

Clair que je ne mérite pas (encore :roll: ) le n°1 ! Par contre toi, ton n°996 te va a ravir :-o  :lol:  :lol:

Et Tom, la prochaine fois qu'on se voit tu me frapperas pas trop fort hein ?
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 23 février 2006 à 10:49:02

Blutch a écrit:
Clair que je ne mérite pas (encore :roll: ) le n°1 ! Par contre toi, ton n°996 te va a ravir :-o  :lol:  :lol:

Et Tom, la prochaine fois qu'on se voit tu me frapperas pas trop fort hein ?

:kc:  :lol:  :lol:  :lol:
même moi, 955, chuis devant poto Tom!!!  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Thomas ARMAND le 23 février 2006 à 11:50:51

Silent Phong a écrit:

Blutch a écrit:
Clair que je ne mérite pas (encore :roll: ) le n°1 ! Par contre toi, ton n°996 te va a ravir :-o  :lol:  :lol:

Et Tom, la prochaine fois qu'on se voit tu me frapperas pas trop fort hein ?

:kc:  :lol:  :lol:  :lol:
même moi, 955, chuis devant poto Tom!!!  :D  :D  :D

996, c'est le nombre de motards que j'ai ATOMISES sur les routes de notre belle région !!!! :D  :D

Une fois que je vous aurai atomisé tout les 2 je passerai à  998, et il m'en faut un autre à  manger (Sylv1 ????) pour passer à  999 !!! :lol:  :lol:  :lol:

Titre: Re : Vos montures en photos
Posté par: Tonyo le 23 février 2006 à 12:05:50
Si c'est que ça, je prend un rocket 3... ;-)
Titre: Re : Vos montures en photos
Posté par: monkey69 le 06 mars 2006 à 21:54:02


Voila mon premier gros cube 600 bandit 2004 ca fai un an que je roule avec :)
Titre: Re : Vos montures en photos
Posté par: Psychose le 07 mars 2006 à 00:58:16
J'aime bien la première photo avec les reflets du soleil mdr  :D
Titre: Re : Vos montures en photos
Posté par: adrien le 07 mars 2006 à 07:54:13


la mienne :D
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 07 mars 2006 à 08:38:43

tom69 a écrit:

Silent Phong a écrit:

Blutch a écrit:
Clair que je ne mérite pas (encore :roll: ) le n°1 ! Par contre toi, ton n°996 te va a ravir :-o  :lol:  :lol:

Et Tom, la prochaine fois qu'on se voit tu me frapperas pas trop fort hein ?

:kc:  :lol:  :lol:  :lol:
même moi, 955, chuis devant poto Tom!!!  :D  :D  :D

996, c'est le nombre de motards que j'ai ATOMISES sur les routes de notre belle région !!!! :D  :D

Une fois que je vous aurai atomisé tout les 2 je passerai à  998, et il m'en faut un autre à  manger (Sylv1 ????) pour passer à  999 !!! :lol:  :lol:  :lol:


mon dieu !!! que c beau le reve !!!!

le seul avantage de ta "Ducat", c'est que son bruit de marteau piqueur nous permet de te retrouver meme apres t'avoir mis 5 kms...... :lol:  :lol:  :lol:  :lol:

alllez poto la prochaine tu ouvre  :bdevil:
Titre: Re : Vos montures en photos
Posté par: Hurl le 07 mars 2006 à 12:07:41

Sylv1 a écrit:

le seul avantage de ta "Ducat", c'est que son bruit de marteau piqueur nous permet de te retrouver meme apres t'avoir mis 5 kms...... :lol:  :lol:  :lol:  :lol:

Et c'est quelqu'un qui a un moteur de mixeur qui se permet de critiquer le son envoutant d'un twin ...
enfin ... peut etre qu'un jour vous aurez du goût  :D
Titre: Re : Vos montures en photos
Posté par: StephMaha le 07 mars 2006 à 12:23:52
HaaaaAAaaa, c'est beau la tolérance....  j'en aurais presque la larme à  l'oeil ....  :D
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 07 mars 2006 à 13:01:02
:D ben heuuu il y a un avantage !! car entre ma tondeuse et mon mixeur je commence a etre sacrément bien équipé a la barraque mouéééé :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 07 mars 2006 à 13:31:27

Hurl a écrit:

Sylv1 a écrit:

le seul avantage de ta "Ducat", c'est que son bruit de marteau piqueur nous permet de te retrouver meme apres t'avoir mis 5 kms...... :lol:  :lol:  :lol:  :lol:

Et c'est quelqu'un qui a un moteur de mixeur qui se permet de critiquer le son envoutant d'un twin ...

"le son envoutant d'un twin" !!!! ptr !! a ca pour faire du bruit ca en fait c clair.....apres pour le reste  :lol:  :lol:  :lol:

rien ne vaut un 4 cylindre qui gueulent dans les tours!!

LEOVINCE Carbonr full powaaaa :lol:  :lol:

non mais! :D
Titre: Re : Vos montures en photos
Posté par: kokiu le 07 mars 2006 à 16:11:23

Sylv1 a écrit:

Hurl a écrit:

Sylv1 a écrit:

le seul avantage de ta "Ducat", c'est que son bruit de marteau piqueur nous permet de te retrouver meme apres t'avoir mis 5 kms...... :lol:  :lol:  :lol:  :lol:

Et c'est quelqu'un qui a un moteur de mixeur qui se permet de critiquer le son envoutant d'un twin ...

"le son envoutant d'un twin" !!!! ptr !! a ca pour faire du bruit ca en fait c clair.....apres pour le reste  :lol:  :lol:  :lol:

rien ne vaut un 4 cylindre qui gueulent dans les tours!!

LEOVINCE Carbonr full powaaaa :lol:  :lol:

non mais! :D

yesssss 4 cylindre pas un de moins
Titre: Re : Vos montures en photos
Posté par: philippe le 07 mars 2006 à 17:19:42

monkey69 a écrit:

Voila mon premier gros cube 600 bandit 2004 ca fai un an que je roule avec :)


Magnifique ce bandit !


Quoi je suis pas objectif ????  :confused:  :roll:  :D  :D

Titre: Re : Vos montures en photos
Posté par: monkey69 le 07 mars 2006 à 19:38:18

bonaweb a écrit:

monkey69 a écrit:

Voila mon premier gros cube 600 bandit 2004 ca fai un an que je roule avec :)


Magnifique ce bandit !


Quoi je suis pas objectif ????  :confused:  :roll:  :D  :D


Merci!  :-)

mais si tu le trouve aussi magnifique que ca!! tu peux rester en mode leche cul et on fait un echange avec la tienne....
on va vite etre copain tu va voir  :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 08 mars 2006 à 09:55:37

Tonyo a écrit:
le numéro c'est le nombre de motards pourris sur la route

Si c'est que ça, je prend un rocket 3... ;-)

Rhhaaaaaaaa!!!!! Totooooooo EXPDRRRRR!!!!! :lol::lol::lol:


kokiu a écrit:
yesssss 4 cylindre pas un de moins

Ralalalalah!!! encore un ignare!!!! hihihi!!! nan, patapé, padeprizdeuJudo!!!
 :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: ptitecox le 13 mars 2006 à 22:09:11
voila ma titine : XJN 1995

( (

( (
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 13 mars 2006 à 22:37:28
Voila les photos de ma petite CB achetée fin septembre dernier apres 1 an de permis en poche sans becane...
Elle est de 2001 et vient de passer les 40 000km ce week end.

- au mois de janvier, faisait encore frisquet  :-o

- Et la, 2 photos toutes fraiches d'hier prises à  "l'arrivée" de la  montée du Mont Verdun  :D

Titre: Re : Vos montures en photos
Posté par: Hurl le 14 mars 2006 à 10:22:14
petitcox: t'a xj est vachement propre pour une machine de 95 !! chapeau :pouces:

pizzai: pareil, tout beau ton cb. j'aime ce modele noir avec les jantes or :-)
Titre: Re : Vos montures en photos
Posté par: nuts le 14 mars 2006 à 14:14:10
ben moi j'essaye de faire fonctionner mon scanner et j'y arrive pas :upset:

je l'aurai un jour je l'aurai ;-)
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 14 mars 2006 à 18:37:39

Hurl a écrit:
pizzai: pareil, tout beau ton cb. j'aime ce modele noir avec les jantes or :-)

Il sera encore plus zoli apres  :D
- coupage de bavette au plus court, et peut-etre changement de plaque
- virer le saute-vent
- remettre le tapis bagster
- remplacer pare-carter 2 points par des roulettes ( et peut-etre protec carbone, a voir)
- sabot si je tombe sur une occaz
- amortos bitubo (reglable précontrainte + detente)
- huile de fourche en 15 (j'hésite pour les cales... pour la route ca ferait peut-etre too much)
- TDF street pour les sessions piste, et peut-etre route si ca me plait
...  :-o
Titre: Re : Vos montures en photos
Posté par: Hurl le 14 mars 2006 à 19:05:05
Mouaif... laisse le donc comme ca.
Les roulettes de protection seront moins efficaces que tes pares carters actuels.
Les amortos, je suis pas convaincu que ce soit indispensable sur une moto comme ca.
Sans le saute vent, tu va encore plus rire sur les longs trajets.
Laisse tomber les cales dans la fourche, à  mon avis, ca ne sera pas terrible sur route.

Meeeenfin, c'est ta moto, t'en fait bien ce que tu en veux (assasin !! :mad: :lol: )
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 14 mars 2006 à 19:48:48

Hurl a écrit:
Mouaif... laisse le donc comme ca.
Les roulettes de protection seront moins efficaces que tes pares carters actuels.
Les amortos, je suis pas convaincu que ce soit indispensable sur une moto comme ca.
Sans le saute vent, tu va encore plus rire sur les longs trajets.
Laisse tomber les cales dans la fourche, à  mon avis, ca ne sera pas terrible sur route.

Meeeenfin, c'est ta moto, t'en fait bien ce que tu en veux (assasin !! :mad: :lol: )

Les amortos... c'est pas indispensable mais c'est un élément de sécurité, confort, et perf  :D
Les amortos de Cb c'est vraiment du caca en boite, passé 25-30 000km... j'ai 40 000.
En fait l'histoire c'est que je comtpe pas changer de becane de si tot. Biensur qu'avoir plus puissant ca me dérangerait pas mais je peux largement m'en passer pour le moment. Ma CB tourne bien, est économique (sans compter l'equipement  :D ), et permet quand meme d'arsouiller. C'est pourquoi je veux l'equiper un petit peu dans ce sens, et aller rouler un peu sur piste avec. D'ou le remplacement des pare-carter par les roulettes (au cas ou ca frotterait, j'aurai pas l'air malin...), d'ou aussi les amortos et l'huile de fourche.

Apres il est certain que je vais faire beaucoup plus de route que de piste.
Le saute-vent je compte le virer car... j'en ai marre de le voir  :lol:
Je le garde de coté en cas de long trajet...
Titre: Re : Vos montures en photos
Posté par: ptitecox le 14 mars 2006 à 20:16:08

Hurl a écrit:
petitcox: t'a xj est vachement propre pour une machine de 95 !! chapeau :pouces:

pizzai: pareil, tout beau ton cb. j'aime ce modele noir avec les jantes or :-)

merci, je l'ai acheté comme ca et j'ai bien l'intension e la bichonner :-)
Titre: Re : Vos montures en photos
Posté par: Coyote le 16 mars 2006 à 18:23:41
Voilà  mon FZ de 89


Ainsi vous me reconnaitrez facilement  :D
Titre: Re : Vos montures en photos
Posté par: philippe le 16 mars 2006 à 19:15:34
Voici la mienne... full origine... et déjà  3000 km au compteur en 3 mois !

Titre: Re : Vos montures en photos
Posté par: Clochette le 17 mars 2006 à 19:15:54
c pas un scooter!!!!
Ca va je rigole patapé :D  :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 18 mars 2006 à 09:57:02
Clair que le XJN et le CB sont en parfait état :pouces: et en noir :love::D

@ Bonaweb: je dis mieux: 15000 en trois mois powoaaa!!!! :lol:
Titre: Re : Vos montures en photos
Posté par: philippe le 18 mars 2006 à 11:21:14

@ Bonaweb: je dis mieux: 15000 en trois mois powoaaa!!!! :lol:

ok je m'incline :chine: oh grand gourou de l'asphalte  :D  :D
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 18 mars 2006 à 11:41:53
Tiens silent, ta photo en signature avec le gros GAAzzz me fait penser que faudra que je prenne un mur en photo a l'occasion :D
Y'a une casse moto ou y'a un gros GAAAAzzzzz peint sur le mur, le long du périph :D
Titre: Re : Vos montures en photos
Posté par: clo le 19 mars 2006 à 23:40:46
voici ma monture (enfin je me décide à  mettre une photo sur ce post) :D


et une petite en couleur

Titre: Re : Vos montures en photos
Posté par: Thomas ARMAND le 20 mars 2006 à 09:11:47
C'est moi, ou t'as oublié d'insérer les photos ??

Titre: Re : Vos montures en photos
Posté par: Psychose le 20 mars 2006 à 09:21:20
Comment elle se la pête Clo avec sa moto exposée la  :D  :D

Sympa et encore + qd tu es dessus  :lol:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 20 mars 2006 à 10:18:03

pizzai69 a écrit:
Y'a une casse moto ou y'a un gros GAAAAzzzzz peint sur le mur, le long du périph :D

ce doit être OJ Bike à  Villeurbanne nan?  :D

ps: GaaaaaAAAAAAAAaaaAAAzzzZZZzzzZ!!!! :yeah:
Titre: Re : Vos montures en photos
Posté par: darkangel le 20 mars 2006 à 12:55:11
Voici ma monture , en photo avec Blackmamba ( c est pas moi hein c est pas moi sur la photo! )


hihihihi  :-)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 20 mars 2006 à 13:10:25
t'en as d'autres des photos comme ça ??? hihihihi ;-);-);-)
Titre: Re : Vos montures en photos
Posté par: StephMaha le 20 mars 2006 à 13:15:39

Silent Phong a écrit:
t'en as d'autres des photos comme ça ??? hihihihi ;-);-);-)

Carrément, et les autres sont beaucoup mieux ....  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 20 mars 2006 à 13:43:23
vi vi !!! je sais bien :lol::-p
Titre: Re : Vos montures en photos
Posté par: Sam le 20 mars 2006 à 14:33:35

Silent Phong a écrit:
t'en as d'autres des photos comme ça ??? hihihihi ;-);-);-)
lol silent, fais pas l'innocent, tu dois les connaitre les photos du 749 de diana, comme beaucoup d'autres... mdr :lol:
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 20 mars 2006 à 15:24:14
ha bon il y aurait d'autres photos du 749 ???? :D  :D  :D  :D  

mheuuu non j'déconne je sais bien aussi :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Tonyo le 20 mars 2006 à 16:05:49
Ahhhhh Blackmamba..... :love: :love: :love:
Désolé Ninja, mais c'est trop dur !!! :D
Titre: Re : Vos montures en photos
Posté par: darkangel le 20 mars 2006 à 18:46:56
hihihi !!

je savais bien que la photo de ma moto ca aurait de succès ,

bien que je sais que personne n' a regardé la moto

c etait juste pour rigoler et je sais que clotilde ne m en voudra pas , hihihihi

Titre: Re : Vos montures en photos
Posté par: eldarin le 20 mars 2006 à 19:01:04
Ah bon?? j'ai loupé un épisode?? moi je voie que la moto! elle est ou blackmamba???  :confused:

Suis trop sage ou quoi??

Titre: Re : Vos montures en photos
Posté par: Rom / Oz / Artpeel le 20 mars 2006 à 19:16:14
sur quel support vous stockez vos imgs, pour aprèes les mettre ligne ?!
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 20 mars 2006 à 20:30:04 pour la plupart :)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 21 mars 2006 à 01:30:43

Tonyo a écrit:
Ahhhhh Blackmamba..... :love: :love: :love:
Désolé Ninja, mais c'est trop dur !!! :D

Tu veux que j'en touche un mot à  Marion espèce de vil paltoquet ??? :D
Titre: Re : Vos montures en photos
Posté par: Psychose le 21 mars 2006 à 13:49:56
bien sur qu'on les a toutes vu les photos et celle que tu as posté est loin d'être la plus sympa huhu. ;)
Titre: Re : Vos montures en photos
Posté par: le 24 mars 2006 à 19:56:10
Bonjour à  tous,
Je ne passe pas souvent par ici mais là  j'ai une bonne nouvelle à  partager.

Voilà  après presque 2 ans et 16000km en GSE 500 j'avais envie de changement, la moto de mes rêves n'étant pas raisonnable (Speed3) pour mon niveau et mon portefeuille j'ai donc commandé mi décembre la moto qui me plaisait, sachant que je n'allais pas rouler l'hiver avec et qu'il fallait que je vende ma GSE j'ai demandé la livraison pour fin février.
J'ai donc depuis 2 semaines ma chtite SV.
J'en suis super content bien que encore en rodage, j'ai à  peine 200 km au compteur pour l'instant, mais ça change déjà  beaucoup du GSE même ma copine s'en est rendu compte.
J'ai hate d'avoir fini le rodage et que le temps soit plus clément.

Trève de blabla place aux photo.
( ( (
( ( (
Titre: Re : Vos montures en photos
Posté par: Sam le 24 mars 2006 à 19:58:01
hé hé féloches pour l'achat :)

et un SV de, un !!!
Titre: Re : Vos montures en photos
Posté par: Thomas ARMAND le 27 mars 2006 à 08:04:08
Féloches Ourson, à  bientà´t sur les routes !!

Titre: Re : Vos montures en photos
Posté par: ChatNoir le 27 mars 2006 à 08:36:26
Un bon gars ça qui passe d'un GSE à  une SV parce qu'un Speed c'est too much pour commencer.  :D

Hummm ?  chuis pas objectif ?   tsss   ;-)
Titre: Re : Vos montures en photos
Posté par: Rom / Oz / Artpeel le 27 mars 2006 à 16:45:14
donc je vous présente mon 525 après une sortie, comment dire, un peu salissante ...


des que je peux je vous présenterai mon arme de route !!! ;-)
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 27 mars 2006 à 19:06:51

Oz a écrit:
donc je vous présente mon 525 après une sortie, comment dire, un peu salissante ...


des que je peux je vous présenterai mon arme de route !!! ;-)

waouuuuhhhh trop la classe....un 525 furtif... :D  :D  :D  :lol:
Titre: Re : Vos montures en photos
Posté par: Rom / Oz / Artpeel le 27 mars 2006 à 19:38:18
je l'aime bien avec les peintures de guerre ....

mais bon oblige de le laver après chaque sortie sinon la casse peut arriver ....

des motos qui demande beaucoup d'entretien.
Titre: Re : Vos montures en photos
Posté par: eldarin le 27 mars 2006 à 19:47:11

Oz a écrit:
je l'aime bien avec les peintures de guerre ....

mais bon oblige de le laver après chaque sortie sinon la casse peut arriver ....

des motos qui demande beaucoup d'entretien.

Ici on la voi pas des briques qu elle est sale, on la voit pas du tout  :D
Titre: Re : Vos montures en photos
Posté par: Sam le 28 mars 2006 à 09:30:18
> Oz : mets la photos sur ImageShack
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 28 mars 2006 à 10:52:57

darkangel a écrit:
Voici ma monture , en photo avec Blackmamba ( c est pas moi hein c est pas moi sur la photo! )


hihihihi  :-)


dites donc les modo quand on a des belles photos comme ca faurait peut etre mettre un lien pour les faire voir au cre..euh au pote...

en tout cas tres jolie....

quoi y'a une moto ? a oui tiens derriere je l'avais pas vu !!! :D

 :10:  :out:

EDIT: y'en a pas d'autre ?? 8-)
Titre: Re : Vos montures en photos
Posté par: NeNe le 07 avril 2006 à 19:13:27
:D  le retour...




Titre: Re : Vos montures en photos
Posté par: VFR01 le 07 avril 2006 à 19:22:46

NeNe a écrit:
:D  le retour...





t'es revenu au gex splendiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiide :-)
Titre: Re : Vos montures en photos
Posté par: Sam le 07 avril 2006 à 20:19:59
hé hé, féloches pour l'acquisition NeNe :)
Titre: Re : Vos montures en photos
Posté par: guillaume le 07 avril 2006 à 20:29:51
Rhhaaaaaaaa c'est Bo çà  mon Néné, change moi vite ce pot par contre, un Gex 1000, faut que çà  cause  :D
Titre: Re : Vos montures en photos
Posté par: NeNe le 08 avril 2006 à 11:09:03
Miciiiiiiiii, pour le pot on va voir, j'ai envie d'un Yosh tri oval pour une fois je trouve que ca lui irait a merveille, mais pour en trouver un pas trop cher d'occase il va falloir du temps  ;-)
Titre: Re : Vos montures en photos
Posté par: Thomas ARMAND le 10 avril 2006 à 08:00:37
Bien joué Néné, il est splendide !!

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 10 avril 2006 à 10:54:04
Waouhhhhhhhhhhh !!!!!! un K2 comme j'avais!!!!! trop d'la boule mon Nénéééééééééééééé!!!!!!! :pouces:
tu m'as bien eu sur ce coup là  ;-) petit menteur vas!!! :lol::lol::lol:
Titre: Re : Vos montures en photos
Posté par: NeNe le 10 avril 2006 à 11:31:39

Silent Phong a écrit:
Waouhhhhhhhhhhh !!!!!! un K2 comme j'avais!!!!! trop d'la boule mon Nénéééééééééééééé!!!!!!! :pouces:
tu m'as bien eu sur ce coup là  ;-) petit menteur vas!!! :lol::lol::lol:

 :lol:  :lol:  nan pas vrai suis pas un vilain menteur  :lol: , j'avais bien signé un 750 2001 a st etienne, mais j'ai eu celui la au meme prix, donc je l'ai pris et en meme temps j'ai perdu l'accompte versé pour le 750... 50€  :D

miciii Tom  ;-)
Titre: Re : Vos montures en photos
Posté par: VANVAN le 10 avril 2006 à 15:58:30
Bon et bien je vous donne apres le son, l'image de moi meme !!!

Edit par hurl: affichage de l'image
Titre: Re : Vos montures en photos
Posté par: VANVAN le 10 avril 2006 à 16:03:04
Pas trop compris pour mettre la photo directement en visu sur le post  :cry:
Titre: Re : Vos montures en photos
Posté par: NeNe le 10 avril 2006 à 17:32:46
la voici VANVAN  ;-)

suffit de faire comme tu avais fait dans ton message d'avant sauf que tu rajoutes [ img ] avant, et [ /img ] apres le lien de ta photo (sans les espaces entre les [  ] et les img)

cela donne a peu pres ca [ img ]lien[ /img ]

Titre: Re : Vos montures en photos
Posté par: Hurl le 10 avril 2006 à 18:37:08
Merci néné ;-)
J'ai corrigé ton post vanvan.

Z'avez vu ? Il porte son cax comme les racailles en scooter ! :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 10 avril 2006 à 18:40:27

Hurl a écrit:
Merci néné ;-)
J'ai corrigé ton post vanvan.

Z'avez vu ? Il porte son cax comme les racailles en scooter ! :D

T'as l'air d'en connaitre un rayon  :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Hurl le 10 avril 2006 à 18:53:54
Ben quand t'es dans le 7eme, t'en vois passer un sacré paquet sur leur scooter avec le cax comme ca ou meme à  l'envers ...
Ou meme certains en hayabusa et tshirt ...
Titre: Re : Vos montures en photos
Posté par: eldarin le 10 avril 2006 à 18:57:56

Hurl a écrit:
Ben quand t'es dans le 7eme, t'en vois passer un sacré paquet sur leur scooter avec le cax comme ca ou meme à  l'envers ...
Ou meme certains en hayabusa et tshirt ...

Ici on est trankill question racaille, a part un en**lé de motard en triumph powa  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 10 avril 2006 à 20:17:37
Mise à  jour de ma CB apres modif des amortos, de la bavette, des roulettes (pour ce qui est visible :D car autres modifs cachées inside)

( (
( (


PS: pourquoi ce forum aime pas les balises url et img en majuscules ?  :upset:
Titre: Re : Vos montures en photos
Posté par: VANVAN le 10 avril 2006 à 20:22:13
;-) MERCI pour le tuyau concernant la photo.Par contre pas cool les gones pour mon casque  :cry: J'avais fait une balade avec des potes dans Lamastre et nous venions de nous arreter au relais motard qui ce situe dans la montee. Au moment de la photo j'etait presque arrive sur le parking du relais voila l'explication....Et puis les racailles je les ATOMISE avec le daytona !!!!!!  :kill:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 10 avril 2006 à 20:26:16

pizzai69 a écrit:
( (

on dirait po angelinez?  :D  :D  :lol:  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: ninja6 le 10 avril 2006 à 20:31:29
bien ce truçage mais bon c'est pas ça
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 10 avril 2006 à 20:46:47
C'est du vite fait :D
Titre: Re : Vos montures en photos
Posté par: krynn le 10 avril 2006 à 22:33:23

Valà .. moi j'ai la jaune et mon ours la bleue...  :D
Titre: Re : Vos montures en photos
Posté par: Psychose le 10 avril 2006 à 22:37:53
Pfiou, c'est beau.... je bave de l'entrejambe la ...
Titre: Re : Vos montures en photos
Posté par: krynn le 11 avril 2006 à 13:47:51
Une autre tof de ma monture... que j'aime bien :D
Titre: Re : Vos montures en photos
Posté par: kokiu le 12 avril 2006 à 07:26:43
ya pas dire c'est beau une honda :love:  :love:  :love:  :love:
Titre: Re : Vos montures en photos
Posté par: BibiHSav le 12 avril 2006 à 07:59:53

pizzai69 a écrit:
( (

Je n'avais jamais remarqué qu'une CB500 pouvait être aussi craquante  :D J'adore  :love:  :love:  :love:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 12 avril 2006 à 10:06:56
Titre: Re : Vos montures en photos
Posté par: StephMaha le 12 avril 2006 à 10:32:11
loool, mort de rire, bien vu le montage  :D
Titre: Re : Vos montures en photos
Posté par: Hurl le 12 avril 2006 à 11:24:48

Ptitducky a écrit:

pizzai69 a écrit:
( (

on dirait po angelinez?  :D  :D  :lol:  :lol:  :lol:  :lol:

 :-o  :-o

Je sais pas tiducky, je l'ai encore jamais vu dans cette tenue là  :-P
Tu nous cacherais des choses ?  :D
Titre: Re : Vos montures en photos
Posté par: NeNe le 23 avril 2006 à 18:27:53
le Yosh nouveau est arrivé, ca se deguste sans fin, le Gsxr c'est bon, mangez en  :D



Titre: Re : Vos montures en photos
Posté par: StephMaha le 23 avril 2006 à 18:39:27
Ha ouais, je l'avais jamais vu monté encore... Ben ca a vraiment de la gueule !!! BRAVOOO !!!


Je me doute que le son doit être à  la hauteur ... :pouces:
Titre: Re : Vos montures en photos
Posté par: krynn le 24 avril 2006 à 11:12:19

NeNe a écrit:
le Yosh nouveau est arrivé, ca se deguste sans fin, le Gsxr c'est bon, mangez en  :D

Tu prètes  ??? ... comme ca on peut pas bien se rendre compte ...  :D
Titre: Re : Vos montures en photos
Posté par: NeNe le 24 avril 2006 à 21:47:19
:-P  :-P  :-P  :-P  qui me parle???  :D
Titre: Re : Vos montures en photos
Posté par: le 25 avril 2006 à 17:17:37
Et voila ma nouvelle monture, pour ceux qui ne la connaissent pas encore !!!


Résultat : que du bonheur, 1500 km en une semaine ... un pneu arrière, le plein de sensation etc etc ...
Raaaaaaaa lovely !!!  :D  :D  :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 25 avril 2006 à 17:29:53
Superbe proverb !  :-)
Titre: Re : Vos montures en photos
Posté par: StephMaha le 25 avril 2006 à 18:20:59
Hé ben .....  :-o

C'est clair qu'elle est splendide !!!! :pouces:
Titre: Re : Vos montures en photos
Posté par: VFR01 le 25 avril 2006 à 18:23:24
:-o splendide en effet proverb jolie monture :10:
Titre: Re : Vos montures en photos
Posté par: Sam le 25 avril 2006 à 19:47:20
Ohh joli le VTR
Il parait qu'il fait un joli bruit...

ben féloches pour l'acquisition... tu collectionnes les motos on dirait lol ;-)
Titre: Re : Vos montures en photos
Posté par: NeNe le 25 avril 2006 à 20:02:14
'gnifique  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Dje le 25 avril 2006 à 22:26:00
Ben voila moi ce n'est pas un VTR ni un gex, seulement un fazer '99 qui m'apporte quand meme bien des surprise!!

Titre: Re : Vos montures en photos
Posté par: NeNe le 25 avril 2006 à 22:31:48
joli en noir, j'ai eu un 2002, super moto  :-)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 26 avril 2006 à 01:17:34
Waouuuuuh Raph' !! superbe ton VTR SP2 !!!! :pouces: c'est qu'il se fait plaiz' le cochon !!!!! t'as bien raison !!! :D
Titre: Re : Vos montures en photos
Posté par: le 26 avril 2006 à 01:33:22

Silent Phong a écrit:
Waouuuuuh Raph' !! superbe ton VTR SP2 !!!! :pouces: c'est qu'il se fait plaiz' le cochon !!!!! t'as bien raison !!! :D

Merci mon tit Raph (j'ai l'impression de me parler  :-P  :-P  ) ... pis merci aux autres  :D  :D
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 26 avril 2006 à 11:45:55

proverb a écrit:

Silent Phong a écrit:
Waouuuuuh Raph' !! superbe ton VTR SP2 !!!! :pouces: c'est qu'il se fait plaiz' le cochon !!!!! t'as bien raison !!! :D

Merci mon tit Raph (j'ai l'impression de me parler  :-P  :-P  ) ... pis merci aux autres  :D  :D

c'est clair qu'elle est belleuuuuuuuuuuu :D

pis pour avoir essayé le SP1 bhaaaaaaaaa ça marcheee c'est hyper rigide........ et ça se met tiptop en glisse dans les rond poind :D .......

si mon bof lit ça je suis mortttt :D  :D

magnifique moto Raph  ;-)
Titre: Re : Vos montures en photos
Posté par: MaxB le 08 mai 2006 à 11:40:46
Ben voili, depuis lundi 1er mai 2006, un V60 a remplacé mon 650 SV-S


Trop génial        :D  :D
Titre: Re : Vos montures en photos
Posté par: Psychose le 08 mai 2006 à 12:44:01
Très jolie, je dis bravo  :D  "top classe"
Titre: Re : Vos montures en photos
Posté par: le 08 mai 2006 à 13:30:13
voici la mienne un fazer de 99 avec plus de 70 000km et elle marche tjs aussi bien(
Titre: Re : Vos montures en photos
Posté par: eldarin le 08 mai 2006 à 19:42:28

fazergirl a écrit:
voici la mienne un fazer de 99 avec plus de 70 000km et elle marche tjs aussi bien(

Superbe  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Hurl le 10 mai 2006 à 16:18:23

MaxB a écrit:
Ben voili, depuis lundi 1er mai 2006, un V60 a remplacé mon 650 SV-S


Trop génial        :D  :D

Copiteur !!!!!  :D  :D
Magnifique cette moto !  :-P
Je t'achete ton capot de selle ! :D

Felicitations ;-)
Titre: Re : Vos montures en photos
Posté par: StephMaha le 11 mai 2006 à 00:22:23
A y eeeeeeeest !!!!  :D

Après presque un mois et demi de "pietonisme", elle est enfin arrivée, il était temps !!!  :pouces:

Rodage et Yamahaaaaa Powaaaaa ...  :-P

Allez quelques p'tites photos rapides à  chaud (bon c'est moche c'est tout d'origine, mais ca va pas durer :lol2:)

( (

( (

( (

( (

Eté et virolos de folie, me voilaaaaaaaa!!!  :D
Titre: Re : Vos montures en photos
Posté par: le 11 mai 2006 à 00:29:00
Bravo steufffffffffffffffffffffff! on retourne sur la napoleon en juin? :-P
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 11 mai 2006 à 02:36:45
Elle est superbe c'teu èrwan !!!!!! :pouces:
y'a plus qu'à  virer les vilains notocollants, la bavette .... hihihi! :D
Titre: Re : Vos montures en photos
Posté par: airpébé le 11 mai 2006 à 02:40:00
content pour toi que tu ai enfin une tomo ,ca a été long mais plus c'est long ......... :D
Titre: Re : Vos montures en photos
Posté par: ZedMed le 11 mai 2006 à 08:13:13
Féloches Stouph, très beau le piano!! Pour le rodage on fait un coup de Napoléon aller-retour??  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Tonyo le 11 mai 2006 à 08:18:25
:pouces: Steph !!!

Mais dis moi :confused: sur ta moto, t'as pas 2 cylindres en trop ???? :lol: :lol:
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 11 mai 2006 à 08:28:01
ellle est magnifique mon salo....

vraiment content que tu t'en sorte comme ca apres ton vol!!!

a bientot pour tes pourris..euh des ballades  :lol:  :D
Titre: Re : Vos montures en photos
Posté par: Sam le 11 mai 2006 à 09:21:13
rah la la elle est magnifique stouph !!!

dis, dis, dis... tu me la préteras :shy:

Titre: Re : Vos montures en photos
Posté par: Blutch le 11 mai 2006 à 10:04:51
Ca y'est, je l'ai récupérée hier soir (comme l'ami Stouph, féloche man elle est superbe !) :saut:

Voilà  donc ce que ça donne :

Non mais ça va pas :freak: Est-ce que j'ai une gueule à  rouler en paquebot moi :no:

Voici la vraie :

Aà¯e, me suis trompé, ça c'est le solex de JoChaps :lol: :lol:

Pour me faire pardonner, je vous mets 2 photos du bolide que je suis allé chercher hier soir chez les verts de St-Etienne :


Je ne sais pas si je vais réussir à  la conduire, je n'ai jamais eu de moto d'aussi petite cylindrée :D Heureusement, j'ai tout le rodage pour apprendre à  la connaitre.

Ce qui change beaucoup par rapport au 1000 GSX-R, c'est :
> La position de conduite : le cul est plus haut, les bras plus bas et les pieds plus en arrière :-o Une position super racing, j'adore !!
> Le moulin : on sent que y'a pas grand chose en dessous de 6000 tr/mn, mais il ne demande qu'à  grimper au dessus !
> L'agilité : on a l'impression d'être sur un vélo, et qu'il n'y a pas de réservoir entre le bout de bois (la selle :lol: ) et le guidon !

En tout cas je suis super content de ma nouvelle titinne, je pense qu'elle sera beaucoup plus adaptée à  la route et au circuit que mon 1000 assez inexploitable :chine:

Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 11 mai 2006 à 10:12:48
yéééééééé hé bé entre celle de Steph et celle de Blutch ça fait deux beaux bébés  :D  :D  :D

content pour vous les gars  ;-)
Titre: Re : Vos montures en photos
Posté par: StephMaha le 11 mai 2006 à 10:36:03
Yeah Blutch ... Bienvenue dans le monde merveilleux des pianistes  :D

Mais dis donc, faudra que tu me donne ton secret pour avoir été aussi rapide sur ce coup !!!  ;-)
Titre: Re : Vos montures en photos
Posté par: Tonyo le 11 mai 2006 à 10:43:11
Blutch !!!!
beh mon salop !!!! elle est top c'te moto !!!!! :-o

bon rodage alors !!! :D
C'est peut etre le seul moment ou on pourra te pourrir !!! :lol: :lol:

Magnifique vos 2 pianos les gars !!! :D
Titre: Re : Vos montures en photos
Posté par: Sam le 11 mai 2006 à 11:06:14
eh beh Blutch féloches :pouces:

heureusement que t'as prévu le stage de piste pour apprivoiser la bête... PTDR :lol: :lol:

va y avoir du fêtage de brele ce soir mdr :D :pint:
Titre: Re : Vos montures en photos
Posté par: clo le 11 mai 2006 à 11:20:53
félicitation blutch, dit donc ta pas trainer pour retrouver une magnifique brèle  :-o .

elle est top  faudrait je 'essaye si c'est aussi incorfortable en SDS que ton feu gex.
Titre: Re : Vos montures en photos
Posté par: VFR01 le 11 mai 2006 à 11:28:47
Stouph j'adore :-)

Blutch ba tu traine po toi  :-o comment tu fais  :confused: mais en tout cas superbe le R6 :-)
Titre: Re : Vos montures en photos
Posté par: Hurl le 11 mai 2006 à 11:37:50
Féloches les gars ! ;-)
J'espère que ce soir on aura droit à  la tournée, mais pas contre, évitez le concert de piano svp :lol:
Titre: Re : Vos montures en photos
Posté par: Sam le 11 mai 2006 à 11:43:32
tiens je vois que j'ai pas posté des photos de ma new moto sur ce topic.

En v'la quelques unes du SS... dans son environnement de prédilection...




eh encore, dommage que j'avais pas mon APN hier chez Speck, sinon c'était le SS sans résé, ni amorto, les courroies et les soupapes à  l'air :lol: :lol: :lol:

Le premier qui sort une réflexion sur les Ducat'... je lui édite son avatar ou son profil  :mad:  :embarras:  :D
Y a que moi qui ais le droit de me moquer ! :-P
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 11 mai 2006 à 13:12:02
Ouéééééééé :yeah: poto Blutchie!!!! woanagain & bizz too fly!!!! :D
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 11 mai 2006 à 13:18:25
Content que ca passe bien pour les victimes de récents vols ;-)

Meme si je préferais le gex au R6 :-o

PS: a votre avis j'aurai droit a un petit R6 si on me vole mon CB ? :-P
Titre: Re : Vos montures en photos
Posté par: le 11 mai 2006 à 14:18:23

Blutch a écrit:

Voici la vraie :

Aà¯e, me suis trompé, ça c'est le solex de JoChaps :lol: :lol:

ouais oauis, en attendant on va aussi vite...  ;-)

(n'empeche c'est déjà  du bon solex ca !  :D )

Titre: Re : Vos montures en photos
Posté par: maya le 11 mai 2006 à 14:31:45
Félicitations à  tous les 2, sont vraiment magnifiques vos nouveaux bébés....

Ca fait trop plaisir ce genre de nouvelles.... ;-)

heu ....prudence tout de même hein ....j'avais prévenu que je ferais ma rabat-joie.... ;-)
Titre: Re : Vos montures en photos
Posté par: BibiHSav le 24 mai 2006 à 22:10:53
Bon j'ose vous montrer la mienne, pourtant elle n'est pas personnalisée :(

Titre: Re : Vos montures en photos
Posté par: pizzai69 le 24 mai 2006 à 22:16:09
Fallait oser  :-(

Titre: Re : Vos montures en photos
Posté par: BibiHSav le 24 mai 2006 à 22:54:26

pizzai69 a écrit:
Fallait oser  :-(

??? Tu veux dire que la moto est achement très du bord ?

Bah c'est du à  la focale que j'utilise. Voici la vraie distance.
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 24 mai 2006 à 22:57:45

BibiHSav a écrit:
Bon j'ose vous montrer la mienne, pourtant elle n'est pas personnalisée :(


Non je parlais pas du bord  :D
Titre: Re : Vos montures en photos
Posté par: ninja6 le 25 mai 2006 à 06:00:19
ouais faut vraiment oser
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 26 mai 2006 à 11:22:14
Titre: Re : Vos montures en photos
Posté par: Kyung le 26 mai 2006 à 11:28:37

Silent Phong a écrit:

bin moi non plus????

super joli le rouge :D
en voyant la première photo je me disais:
"bin merde l'est o๠le sds???" :D
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 26 mai 2006 à 12:26:01
Allez en avant premiere: mon CB presque pret pour Bresse :
( (  ( (

Titre: Re : Vos montures en photos
Posté par: sphinx le 13 juin 2006 à 14:07:05
je vous presente ma titine a moi !!!
elle est de 93, elle a 38000 Km, je l'ais depuis 3 mois (permis moto il y a un an), elle est bridé en 34 cv ...  :-(
mais bon j'ai travaillé dur et j'ai surement raté ma 2eme d'IUT pour elle mais bon elle vallait le coup !!!!
(bon lors de la séance photos elle etait pas trés propre et j'avais pas encore poli ma ligne ... je m'en excuse   :-?  )

voila donc ma titine rien qu'a MOI ! :

( (

( (

si yen a un qui ose dire une seul reflection sur ma titine jle ********* :kill:  :kill:  :kill:  :kill:  :kill:   :-?
Titre: Re : Vos montures en photos
Posté par: le 14 juin 2006 à 09:54:54
et voila la plus jeune ^^

Titre: Re : Vos montures en photos
Posté par: guillaume le 14 juin 2006 à 20:39:54
Et encore un SVS  :D Avec une suberbe bavette toute d'origine même pas honte 8-)


Et enfin la petite soeur prépa dynojet stage 5 full méthanol :D

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 15 juin 2006 à 01:34:06
P'tain Guigui :lol: !!!! la prochaine fois que je te vois, je te l'explose...... ta bavette bien sûr!!!!! :D
Titre: Re : Vos montures en photos
Posté par: StephMaha le 15 juin 2006 à 01:44:48
Pourtant c'est pas faute d'avoir dit à  Mike de la squizzer cette "proéminence disgrà¢cieuse"   :D
Titre: Re : Vos montures en photos
Posté par: Psychose le 27 juin 2006 à 00:28:39
Comment qu'on conduit avec un truc aussi gros sur le réservoir? *Want to know*
Titre: Re : Vos montures en photos
Posté par: guillaume le 27 juin 2006 à 18:52:27

Psychose a écrit:
Comment qu'on conduit avec un truc aussi gros sur le réservoir? *Want to know*

Pour cela il faut être Maître Jedi petit Padawan  :chine:
Titre: Re : Vos montures en photos
Posté par: nico le 05 juillet 2006 à 22:24:42

ma moto!
 :-)  :D
Titre: Re : Vos montures en photos
Posté par: Clochette le 20 juillet 2006 à 19:21:04
Un petit UP pour les nouveaux ca fait longtemps!!! ;-)
Titre: Re : Vos montures en photos
Posté par: Manu le 25 juillet 2006 à 16:08:28
A poil la miss....  ;-)


Titre: Re : Vos montures en photos
Posté par: Sam le 25 juillet 2006 à 17:11:16
c'est une photo prise au trofeo rosso, nan ?
Titre: Re : Vos montures en photos
Posté par: Manu le 25 juillet 2006 à 17:21:20

Sam a écrit:
c'est une photo prise au trofeo rosso, nan ?

En effet  ;-)
Je tournais en Nuevo avec une copine sur un 800 ssie jaune.
Tu y etais ?

une autre pour la route :

Titre: Re : Vos montures en photos
Posté par: Sam le 25 juillet 2006 à 17:23:24

Mr_Poulpe a écrit:

Sam a écrit:
c'est une photo prise au trofeo rosso, nan ?

En effet  ;-)
Je tournais en Nuevo avec une copine sur un 800 ssie jaune.
Tu y etais ?

non je n'y étais pas malheureusement (j'avais un truc à  bosser je crois...). Mais j'ai raté quelque chose visiblement d'après Mash... snif j'aurais du y aller...

Ca devait être sympa de tourner au vigeant.
Titre: Re : Vos montures en photos
Posté par: le 25 juillet 2006 à 17:34:16
bon ben ma nouvelle monture de dans x ans :
Titre: Re : Vos montures en photos
Posté par: Manu le 25 juillet 2006 à 17:50:07

Sam a écrit:
non je n'y étais pas malheureusement (j'avais un truc à  bosser je crois...). Mais j'ai raté quelque chose visiblement d'après Mash... snif j'aurais du y aller...

Ca devait être sympa de tourner au vigeant.

En effet, comme d'hab, ambience familliale et sympatique, les sides ont fait leur Show, la grele fut de la partie etc...
Mash a bien tenté (encore merci ;-) ya une biére qui t'attend)  de me montrer le deanché, ya que les bottes et les pots qui ont frottés...  :lol:
mais le virus est pris et je cherche une tite 900 parceque la Stitou.... c'est un peu "camionesque".

Titre: Re : Vos montures en photos
Posté par: Sam le 25 juillet 2006 à 18:06:36

Mr_Poulpe a écrit:
mais le virus est pris et je cherche une tite 900 parceque la Stitou.... c'est un peu "camionesque".
hé hé, un p'tit 900 SS ;)
Titre: Re : Vos montures en photos
Posté par: Manu le 25 juillet 2006 à 18:28:41

Sam a écrit:

Mr_Poulpe a écrit:
mais le virus est pris et je cherche une tite 900 parceque la Stitou.... c'est un peu "camionesque".
hé hé, un p'tit 900 SS ;)

Ezactement, et la question est Carbu ou Ie......  :confused:

Manu, trop dure la vie.....  :lol:
Titre: Re : Vos montures en photos
Posté par: sandy le 04 août 2006 à 19:36:07
du SV  en veu tu??  en voila !!  :-P

Titre: Re : Vos montures en photos
Posté par: cool_eyer le 05 août 2006 à 10:10:15

tracks76 a écrit:
du SV  en veu tu??  en voila !!  :-P


Ahhhh, elle est clean !!
Titre: Re : Vos montures en photos
Posté par: Sam le 05 août 2006 à 12:04:39

tracks76 a écrit:
du SV  en veu tu??  en voila !!  :-P
tiens un SV... pour changer

sympa le tien... à  part les Mez !
Titre: Re : Vos montures en photos
Posté par: sandy le 05 août 2006 à 12:14:59

Sam a écrit:

tracks76 a écrit:
du SV  en veu tu??  en voila !!  :-P
tiens un SV... pour changer

sympa le tien... à  part les Mez !

Ouai !! je dirais même pas terrible du tout !! ils étaient dessus a l'achat neuf ... je me reflou un peu les poches et HOP je change tout ca !

Titre: Re : Vos montures en photos
Posté par: Sam le 05 août 2006 à 12:19:57

tracks76 a écrit:
Ouai !! je dirais même pas terrible du tout !! ils étaient dessus a l'achat neuf ... je me reflou un peu les poches et HOP je change tout ca !

sur le SV, BT010/BT020 ou Power, ça va bien ;-)
Titre: Re : Vos montures en photos
Posté par: sandy le 06 août 2006 à 10:10:01

sur le SV, BT010/BT020 ou Power, ça va bien ;-)[/quote]

ok merci ! je fait confiance au experte  ;-)
Titre: Re : Vos montures en photos
Posté par: MaxB le 06 août 2006 à 20:45:56
Sur mon SV-S, j'avais mis des D207 (Dunlop) et c'était génial...
Moto transformée, bcp plus maniable, très bon grip.
Le seul "inconvénient", c'est qu'ils s'usaient plus vite que d'autres (style BT020), mais si j'avais du les changer j'aurais repris les mêmes.

Titre: Re : Vos montures en photos
Posté par: sphinx le 09 août 2006 à 00:12:18
trés zoli monture mademoiselle...

tu va bien t'entendre avec maya toi.... :-)
Titre: Re : Vos montures en photos
Posté par: christophe rochet le 14 août 2006 à 04:05:03
voici ma mienne
only piste

apres une petite douche

et vu par l objectif de diana
Titre: Re : Vos montures en photos
Posté par: Gérard le 15 août 2006 à 09:31:20
và cciné à u "ricin" depuis 1966..........
voilà  mes "meules":

[img=] (
[img=] (
[img=] (

j'à i plié le Bà ndit à  là  Sà rthe en début de sà ison ! (et là  mà in droite du bonhomme à vec!)
le TD3 devrà it rouler à  Pà u le 9 septembre (si le toubib me confirme que tout est OK)
Le RDLC và  se refà ire une bonne mécà nique, et une peinture à  là  c.. , pour les rà llyes 2007
çà  pourrà it donne çà :

[img=] (

voilà , voilà  !
Titre: Re : Vos montures en photos
Posté par: Olivier le 15 août 2006 à 15:30:49
Voilà  donc la mienne. Modeste mais tellement talentueuse! :D





1999, 39000km, comme neuve! :10:
Titre: Re : Vos montures en photos
Posté par: cuarved le 15 août 2006 à 23:36:51
Voici mon destrier :D enfin mes 106 poneys :lol:
Tout est d'origine sauf les durites avia Goodridge (installées après la photo),
les tampons TopBlock et le support de plaque minéralogique.
Oui c'est presque que la même que No69 :-P

[img=] (
Titre: Re : Vos montures en photos
Posté par: MM69 le 15 août 2006 à 23:47:49

cuarved a écrit:
Voici mon destrier :D enfin mes 106 poneys :lol:
Tout est d'origine sauf les durites avia Goodridge (installées après la photo),
les tampons TopBlock et le support de plaque minéralogique.
Oui c'est presque que la même que No69 :-P

[img=] (

sauf que t'as pas décollé les autocollants  :D
Titre: Re : Vos montures en photos
Posté par: sandy le 16 août 2006 à 00:19:55
elle en jette ... :pouces:
Titre: Re : Vos montures en photos
Posté par: sphinx le 16 août 2006 à 00:42:24
ya pas a dire elle est sublime ... :love:

sauf ce petit pot .... :oh:
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 16 août 2006 à 13:10:29

Olive a écrit:
Voilà  donc la mienne. Modeste mais tellement talentueuse! :D





1999, 39000km, comme neuve! :10:

T'aurai pu prendre le meme pseudo que sur R-CB5 quand meme  :D
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 19 août 2006 à 01:45:44
Ma Nénette a moi !! :D

Titre: Re : Vos montures en photos
Posté par: NeNe le 19 août 2006 à 12:29:22

ZUM69 a écrit:
Ma Nénette a moi !! :D


 :D  :D  :D  ma kél kuuuuuuuu  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 19 août 2006 à 13:03:50
J'osai pas l'dire !!!
C'est son profil que j préfère !
J adore son ti cul! Mais moins que le tiens mon NéNé (
Titre: Re : Vos montures en photos
Posté par: NeNe le 19 août 2006 à 18:26:16
:lol:  :lol:  :lol:  :lol:

Titre: Re : Vos montures en photos
Posté par: cool_eyer le 20 août 2006 à 08:42:53
Ben oui, c'est beau... :D  :D  :D

Titre: Re : Vos montures en photos
Posté par: zigzigeur le 20 août 2006 à 09:57:09
y'a pas a dire ca a vraiment de la gueule tous ca mais bon ca reste ducat!! :D
Titre: Re : Vos montures en photos
Posté par: Sam le 20 août 2006 à 10:33:43
Belle moto cool :D
Titre: Re : Vos montures en photos
Posté par: christophe rochet le 20 août 2006 à 12:37:45

zigzigeur a écrit:
y'a pas a dire ca a vraiment de la gueule tous ca mais bon ca reste ducat!! :D
j osai pas le dire :D
Titre: Re : Vos montures en photos
Posté par: guillaume le 20 août 2006 à 13:16:24

chriszx6rr a écrit:

zigzigeur a écrit:
y'a pas a dire ca a vraiment de la gueule tous ca mais bon ca reste ducat!! :D
j osai pas le dire :D

Faut aimer un peu le bricolage c'est tout  :D

Mode Pourrisage Off
Titre: Re : Vos montures en photos
Posté par: Sam le 20 août 2006 à 17:31:56
lol guillaume... oui moi je croi s qu'un jour je vais perdre un des pots :embarras: :roll:
Titre: Re : Vos montures en photos
Posté par: eldarin le 20 août 2006 à 19:16:24

Sam a écrit:
lol guillaume... oui moi je croi s qu'un jour je vais perdre un des pots :embarras: :roll:

 :-o  :-o

Ce serai vraiment pas de .... pots  :-)
Titre: Re : Vos montures en photos
Posté par: Hurl le 22 août 2006 à 11:05:45
Magnifique ton SS cool_eyer ! :pouces:
Titre: Re : Vos montures en photos
Posté par: mcflyom le 22 août 2006 à 11:26:33
Comme prévu mon roadster trés trés méchant ;)


Titre: Re : Vos montures en photos
Posté par: Atok le 22 août 2006 à 20:13:50
Voici ma nouvelle



Titre: Re : Vos montures en photos
Posté par: NeNe le 22 août 2006 à 20:57:42
superbes, la Gsr et ta SV Atok, felicitations  ;-)
Titre: Re : Vos montures en photos
Posté par: Hurl le 23 août 2006 à 10:21:53
Bien propre ton SV Atok
On dirait tonyo mais en tout petit :-P
Titre: Re : Vos montures en photos
Posté par: MM69 le 23 août 2006 à 10:27:41

Hurl a écrit:
Bien propre ton SV Atok
On dirait tonyo mais en tout petit :-P

On dirait surtout ma rue....  :lol:  :-P  :D
Titre: Re : Vos montures en photos
Posté par: Atok le 23 août 2006 à 11:36:55
Je vais en prendre d'autre avec un cadre plus sympa et avec de la lumière ce coup ci  :lol:
Titre: Re : Vos montures en photos
Posté par: le 23 août 2006 à 12:59:20
:lol: voici la mienne :lol:
Titre: Re : Vos montures en photos
Posté par: Didier le 23 août 2006 à 14:55:24
A moi à  moi !!!

Bon certains l'on déjà  vu, et j'en connais même un qui l'aurait conduit !!! Mais bon je vous la montre quand même !
( ( (
Voila !!!
Titre: Re : Vos montures en photos
Posté par: Atok le 23 août 2006 à 15:01:36
Allez !!!!!

On n'est pas nombreux, on s'la montre !!!! :-o  :lol:
Titre: Re : Vos montures en photos
Posté par: Didier le 23 août 2006 à 15:22:26

Atok a écrit:
Allez !!!!!

On n'est pas nombreux, on s'la montre !!!! :-o  :lol:
Mais euuuhhh !!! T'as pas l'droit !! J'vais tout dire !

 :tongue:  :-P  :D
Titre: Re : Vos montures en photos
Posté par: ptiteguepe le 23 août 2006 à 17:20:49
A la demande générale... hihihi  !!! je vous présente Sacha ( :D  :D ), pas si ancienne que ça, puisque certains pensent qu'il s'agit d'une ancêtre... : elle est de 99.

( (

Hein qu'elle est trèèèès bêêêlle ?!?  8-)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 23 août 2006 à 17:57:31
euh.... alors..... comment dire? elle est vachement........!!!!! :lol:

et puis c'est une drà´le de coutume que te promener ses ordures ménagères!!!!!!!! :lol::lol::lol:

(jeu déconnnnneuuuh!!!!!!!!!!:D)
Titre: Re : Vos montures en photos
Posté par: eldarin le 23 août 2006 à 19:18:58
MDR silent, Handibag powa! lol

En tout cas le CB en DDE, j'aime bien  :-)
Titre: Re : Vos montures en photos
Posté par: kali le 23 août 2006 à 21:09:18

Silent Phong a écrit:
euh.... alors..... comment dire? elle est vachement........!!!!! :lol:

et puis c'est une drà´le de coutume que te promener ses ordures ménagères!!!!!!!! :lol::lol::lol:

(jeu déconnnnneuuuh!!!!!!!!!!:D)


A ma guêpe : tu vois bien chérie que j'avais beaucoup plus de classe que toi pendant nos vacances !   :D   8-)

( (
Titre: Re : Vos montures en photos
Posté par: greg le 23 août 2006 à 22:35:29

ptiteguepe a écrit:
A la demande générale... hihihi  !!! je vous présente Sacha ( :D  :D ), pas si ancienne que ça, puisque certains pensent qu'il s'agit d'une ancêtre... : elle est de 99.

( (

Hein qu'elle est trèèèès bêêêlle ?!?  8-)

euh elle commence a à  avoir des allures d'ancetre  :lol:  :lol:  :D
Titre: Re : Vos montures en photos
Posté par: Hurl le 24 août 2006 à 11:24:05

kali a écrit:
A ma guêpe : tu vois bien chérie que j'avais beaucoup plus de classe que toi pendant nos vacances !   :D   8-)

( (

Ouais c'est sur, entre la moto pour poubelles et les WC improvés au bord de la route, niveau classe, on peut pas faire pire ... :lol:
Titre: Re : Vos montures en photos
Posté par: kali le 24 août 2006 à 11:29:22
Tu fais erreur mon grand, c'est moi qui prend la photo et là  elle fait pas caca la guêpe !  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Thibault le 24 août 2006 à 13:00:00
Voila mon bébé !!!



Titre: Re : Vos montures en photos
Posté par: sphinx le 24 août 2006 à 13:50:20
elle est vraiment belle !!!! :love:

fourche inversé ca pete !!!!!  8-)

mais faut absolument virer ce silencieux.... :oops:
Titre: Re : Vos montures en photos
Posté par: Hurl le 24 août 2006 à 14:02:10
Très propre m'enfin c'est une yam

Et je voudrais pas dire, y'en a qui se foutent de la gueule des italiennes, mais vous avez vu la méchante tache d'huile à  coté de cette moto toute neuve ??? :D
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 24 août 2006 à 14:08:49
Moi j'aime bien la FZ1N jaune ou noir, ca en jette (pas comme un Z1000....) :D
Titre: Re : Vos montures en photos
Posté par: Thibault le 24 août 2006 à 14:11:23

sphinx a écrit:

mais faut absolument virer ce silencieux.... :oops:

au debut que j'ai l'avait achetée ... je ne l'aimait pas et puis maintenant je l'aime bien (en plus même d'origine elle fait un bruit sympa). De plus tout les silencieux sont taillés court type Moto GP dc c'est pas mieux


Hurl a écrit:
Très propre m'enfin c'est une yam

Et je voudrais pas dire, y'en a qui se foutent de la gueule des italiennes, mais vous avez vu la méchante tache d'huile à  coté de cette moto toute neuve ??? :D

alors toi quel Boulet !!!  :D  :D  je venais juste de la laver, et la c'est les dernières gouttes

PS : j'avoue très honnetement que Ducat' c'est de la bonne Moto
Titre: Re : Vos montures en photos
Posté par: eldarin le 24 août 2006 à 14:19:14
Sympas ton Fz1  :-)

Par contre t'as fait une faute de frappe : on dit pas ducat c'est de la bonne, mais belle moto ! Parceque sinon, demande a toto   :D
Titre: Re : Vos montures en photos
Posté par: ZedMed le 24 août 2006 à 14:41:55

Ptitducky a écrit:
Moi j'aime bien la FZ1N jaune ou noir, ca en jette (pas comme un Z1000....) :D

Venant d'un kéké qui fait des wheeling de 20 cm, ça ne me touche pas... :D
Titre: Re : Vos montures en photos
Posté par: Atok le 24 août 2006 à 14:52:57
Moi je pouvait pas faire de wheeling  :yeah: sauf avec un passager (et j'ai jamais dépassé 20cm....).   :lol:

(34 cv powaaaa)  :lol:
Titre: Re : Vos montures en photos
Posté par: knives_69 le 25 août 2006 à 22:22:39

sphinx a écrit:
elle est vraiment belle !!!! :love:

fourche inversé ca pete !!!!!  8-)

mais faut absolument virer ce silencieux.... :oops:

Toi et les silencieux  ;-)
Titre: Re : Vos montures en photos
Posté par: Pierre Col le 07 septembre 2006 à 18:24:50
Titre: Re : Vos montures en photos
Posté par: Pierre Col le 07 septembre 2006 à 18:25:48
Titre: Re : Vos montures en photos
Posté par: Pierre Col le 07 septembre 2006 à 18:27:31
Titre: Re : Vos montures en photos
Posté par: Hurl le 07 septembre 2006 à 19:22:13
Dis m'sieur, tu me la donne ? :D

La BM est super propre, comme neuve on dirait !
Titre: Re : Vos montures en photos
Posté par: Pierre Col le 07 septembre 2006 à 20:52:37
La BM est super propre, comme neuve on dirait !

Refaite à  neuf il y a 2 ans par un spécialiste des béhèmes, à  partir de
- un cadre de R 80 RT ex-CRS (eh oui avant elle était immatriculée 69N-XXXX et j'ai encore sur le capot en plastoc du guidon les boutons pour la sirène et le gyrophare :
- un moteur+boîte+pont de  R 100 RT (70 ch hein !)

Le tout démonté, vérifié, remonté, peinture complète soignée avec filets peints à  la main etc.

Autres photos (très grosses)
Titre: Re : Vos montures en photos
Posté par: cool_eyer le 07 septembre 2006 à 22:48:30
Nickel, et nickel...

je suis occupé à  tirer la langue là ...
Titre: Re : Vos montures en photos
Posté par: Philippe le 11 septembre 2006 à 19:59:29
a mon tour de vous remettre ma belle tte réparée et de nveau prete a me faire plaisir.

merci aux magiciens, adri et gizmo pour tt ce qui est remontage mecanique, monkey69 pour la carrosserie et mon porte feuille pour les frais que j'ai eu...  :roll:
bien entendu, je n'oublies pas tt ceux qui m'ont soutenu au cours du retablissement physique, psychologique et mecanique.

vivement ce week end que je lui degourdisse les bielles  :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 11 septembre 2006 à 20:11:42
Elle est comme neuve!! superbe et nikel !  :-)

Feloche aux mécano-carrossiers!
Titre: Re : Vos montures en photos
Posté par: Hurl le 12 septembre 2006 à 10:45:13
Oooh, elle brillleee ! :-P

Par contre, t'a pas mis de barre anti retournement ? :lol:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 12 septembre 2006 à 11:12:58
ou un arceau de rallye !!! :lol:
Titre: Re : Vos montures en photos
Posté par: eldarin le 12 septembre 2006 à 11:25:24
Des genouilléres intégrées pour mme  :D
Titre: Re : Vos montures en photos
Posté par: François le 12 septembre 2006 à 21:24:21

Hurl a écrit:
Oooh, elle brillleee ! :-P

Par contre, t'a pas mis de barre anti retournement ? :lol:

 :lol:  :lol:  :lol:  :lol:  :lol:  :lol:

Missant vilaing !!!!!!

Et pas de quoi Lippé, j'aime bien les puzzle  ;-)

Chui content que t'ai à  nouveau une zolie moto !
Titre: Re : Vos montures en photos
Posté par: Hurl le 13 septembre 2006 à 10:11:12
Naaaaan !!!
Guizmo, me dit pas que t'a pris un mixer jap ???!!
Titre: Re : Vos montures en photos
Posté par: Kokito le 17 septembre 2006 à 00:30:21
Mon nouveau joujou que je suis allé chercher ce matin à  Dardilly


Titre: Re : Vos montures en photos
Posté par: super_lapin le 17 septembre 2006 à 10:23:42
Ouh la belle bête !  :-o  :-o
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 17 septembre 2006 à 11:25:16
Et c'est à  partir de là  que les enmerdes commencèrent !!!! :lol:

(j'déconne bien sûr ;-) ...... quoique..... hihihi!)

Sinon, jolie brêle quand même :D
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 17 septembre 2006 à 12:57:33

Silent Phong a écrit:
Et c'est à  partir de là  que les enmerdes commencèrent !!!! :lol:

(j'déconne bien sûr ;-) ...... quoique..... hihihi!)

Sinon, jolie brêle quand même :D

ha bon ??  :D  je vois pas le boulon par terre  :D  ....mince ma vu baisse  :D  :D  :D

c'est une belle mottttt heuu ducat  :D

@ Hurl ........ tu sais ce qu'ils te disent les mixer jap??  :D  :D  :D

tu sors  :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 17 septembre 2006 à 18:15:07
Belle machine!!  :-)
Titre: Re : Vos montures en photos
Posté par: adrien le 17 septembre 2006 à 19:10:14

gizmo69 a écrit:

Hurl a écrit:
Oooh, elle brillleee ! :-P

Par contre, t'a pas mis de barre anti retournement ? :lol:

 :lol:  :lol:  :lol:  :lol:  :lol:  :lol:

Missant vilaing !!!!!!

Et pas de quoi Lippé, j'aime bien les puzzle  ;-)

Chui content que t'ai à  nouveau une zolie moto !

+1 moi aussi j'aime bien les puzzles puis sa ma occupé un week end  :D
Titre: Re : Vos montures en photos
Posté par: cool_eyer le 18 septembre 2006 à 08:59:53
Tiens ! Une vraie moto !!  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: maya le 18 septembre 2006 à 09:52:41
Tiens ! Une vraie moto !!  

Vouiiiiiii... mais pour combien de temps ..... :D  :D  :D

c'était trop trop tentant j'ai pas pu résister..... :D  :D  :D mais elle magnifique tout de même .... :D  :D  :D  [mode rattrappage on]
Titre: Re : Vos montures en photos
Posté par: Philippe le 18 septembre 2006 à 14:52:50

adrien a écrit:

gizmo69 a écrit:

Hurl a écrit:
Oooh, elle brillleee ! :-P

Par contre, t'a pas mis de barre anti retournement ? :lol:

 :lol:  :lol:  :lol:  :lol:  :lol:  :lol:

Missant vilaing !!!!!!

Et pas de quoi Lippé, j'aime bien les puzzle  ;-)

Chui content que t'ai à  nouveau une zolie moto !

+1 moi aussi j'aime bien les puzzles puis sa ma occupé un week end  :D

ca t'a fait l'occasion de venir sur Lyon et de deguster qques bieres... heureusement que je ne payait que des pack et non pas la main d'oeuvre...
Titre: Re : Vos montures en photos
Posté par: tchoutch le 18 septembre 2006 à 19:56:40
et voila la mienne . petite mais costaude
Titre: Re : Vos montures en photos
Posté par: StephMaha le 21 septembre 2006 à 03:39:56
:D  Après un long périple dans le nord de la France pour aller la chercher, 2 points de moins et 90€ d'amendes pour la ramener dans notre belle contrée (pour, je vous le donne en mille, excès de vitesse  :-P ), voici ma nouvelle petite chérie ...

De la balle à  priori, bien qu'avoir tà¢té de l'interception avec la Subaru ai calmé mes ardeurs  :-( (mais c'était mérité) ...

( (

A moi les virées hivernales et le circuit de Bresse !!!  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: VFR01 le 21 septembre 2006 à 08:35:18
t t'es fais plaisir mon stouph  :-) par contre t'a tater de l'interception par un subaru  :-( arf pas cool ça
Titre: Re : Vos montures en photos
Posté par: Sam le 21 septembre 2006 à 08:40:33
ben bravo pour l'excès de vitesse !!!!

féloches pour l'acquisition... :pint: :pint:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 21 septembre 2006 à 09:54:24
Elle est super ta Gex Stephzuki !!!! :lol:

Et les pots de la R6 à  tchoutch sont terribles :pouces:
Titre: Re : Vos montures en photos
Posté par: ZedMed le 21 septembre 2006 à 11:01:33
Bon ben féloches Stephzuki... :D  ;-)
Titre: Re : Vos montures en photos
Posté par: Coyote le 21 septembre 2006 à 14:50:05
Content de te revoir en brêle steph
Titre: Re : Vos montures en photos
Posté par: Kyung le 21 septembre 2006 à 17:07:34
Yooooooooo une Suz excellent choix :D
Titre: Re : Vos montures en photos
Posté par: Hurl le 21 septembre 2006 à 17:11:44
Bravo Stouph, mais ca s'arrose ! :pint: :pint: :D
Titre: Re : Vos montures en photos
Posté par: frédéric fasolino le 21 septembre 2006 à 17:18:47

Coyote a écrit:
Content de te revoir en brêle steph

j'ai loupé un wagon là   :confused:

t'avais plus ton R1 steph  :confused:
Titre: Re : Vos montures en photos
Posté par: Hurl le 21 septembre 2006 à 17:20:05

lestouil a écrit:

Coyote a écrit:
Content de te revoir en brêle steph

j'ai loupé un wagon là   :confused:

t'avais plus ton R1 steph  :confused:

Non il avait trop honte de rouler en yam :D
Titre: Re : Vos montures en photos
Posté par: sandrine le 21 septembre 2006 à 17:31:59
Elle est zoulieeeee Steph ta Suz :D ....pourquoi avoir changé du R1  ?
et le bicylindre italien tu n'y as pas pensé  :-P ? euh moi je dis ça comme ça   :roll:  :roll:  :D  :D  :wg:
 ...En tout cas au plaisir de rouler de nouveau avec toi à  Bresse  :D  :-)  ;-)
Tchouch jolie ta photo avec la mer derrière ;-)

tsusss _______________  :moto2:
Titre: Re : Vos montures en photos
Posté par: NeNe le 21 septembre 2006 à 21:41:42
hummm encore un gex ca se multiplie ces petites betes la  :D

felicitations Steph elle est superbe  :D
Titre: Re : Vos montures en photos
Posté par: StephMaha le 22 septembre 2006 à 03:35:46

Hurl a écrit:

lestouil a écrit:

Coyote a écrit:
Content de te revoir en brêle steph

j'ai loupé un wagon là   :confused:

t'avais plus ton R1 steph  :confused:

Non il avait trop honte de rouler en yam :D

Héééé, spice de méchant, ce n'est pas parceque je fais une infidélité a Yam que mon coeur s'en est allé de l'autre coté du rond-point (cf Dardilly  :-P )

Pour ceux qui avaient raté un wagon, petit passage financier difficile cet été donc vendage, et rachetage du missile pour ne pas mourrir idiot (par contre c'est un coup a mourir tout court  :D )
Titre: Re : Vos montures en photos
Posté par: eldarin le 22 septembre 2006 à 07:30:10
Un 750, tre bon choix !

Feloche stouphinette !!  :-)
Titre: Re : Vos montures en photos
Posté par: tchoutch le 22 septembre 2006 à 23:22:16

Silent Phong a écrit:

 les pots de la R6 à  tchoutch sont terribles :pouces:

Titre: Re : Vos montures en photos
Posté par: clo le 23 septembre 2006 à 12:46:20
je me suis rendu compte que j'avais jamais mis ma moto en photo sur ce post.

donc la voici: excuser moi mais j'ai pas encore  eu le temps de la réparer.



ça cétait  juste  après la  peinture que m'a faite  mon pti chéri moumouss  :-)  :

Titre: Re : Vos montures en photos
Posté par: Kokito le 23 septembre 2006 à 18:27:50
Ouahou magnifique le monstre ...  :-o  :-o
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 23 septembre 2006 à 21:28:07
elle pete ta ges Steph  :pouces:

arfff GSXRMAN va encore faire piapiapia   :D  :D  :D  :D

et Clo joli ton monstre en effet  :pouces:
Titre: Re : Vos montures en photos
Posté par: frédéric fasolino le 30 septembre 2006 à 10:10:58
bon ben !

féloche pour le gex stephkiki  :-P  :-P  :lol:  :D  :lol:  :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 30 septembre 2006 à 19:03:40

Fireblade98 a écrit:

et Clo joli ton monstre en effet  :pouces:

Oui oui oui.... il est beau enmousse  :D
Titre: Re : Vos montures en photos
Posté par: Frédéric le 02 octobre 2006 à 11:31:13

eldarin a écrit:

Fireblade98 a écrit:

et Clo joli ton monstre en effet  :pouces:

Oui oui oui.... il est beau enmousse  :D

MDR Darinou :lol:  :lol:  :lol:

En meme temps c'est tellement vrai 8-)  :D
Titre: Re : Vos montures en photos
Posté par: philippe le 05 octobre 2006 à 17:07:57
Ma nouvelle compagne... évolution (presque) logique après le Bandit 6.5

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 06 octobre 2006 à 02:09:51
Héhéhé!!! pas mal du tout, il claque bien en rouge!! :pouces:

Par contre, fais attention au surplus de powaaaa, y'en a qui ont essayé.... y'z'ont eu des problèmes :lol: ..... wheeling de la mort powaaaaaa!!!!!!!!!!!!!!!!! :lol:
;-) (il se reconnaitra hihihi!)
Titre: Re : Vos montures en photos
Posté par: eldarin le 06 octobre 2006 à 07:24:33

Silent Phong a écrit:
Héhéhé!!! pas mal du tout, il claque bien en rouge!! :pouces:

Par contre, fais attention au surplus de powaaaa, y'en a qui ont essayé.... y'z'ont eu des problèmes :lol: ..... wheeling de la mort powaaaaaa!!!!!!!!!!!!!!!!! :lol:
;-) (il se reconnaitra hihihi!)

 :kc:  :kc:  :D  :D  :D  :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: vans le 07 octobre 2006 à 09:50:26
salut tous ....

alors on y va ... ma prem's (et preum's peinture en meme temps .... attention ca fait mal aux yeux  :D )

( (

ensuite la suivante toujours apres remasterisation .... :D

( (

( (

et enfin ce qui m'est arrive de mieux a ce jour (enfin apres avoir rencontre mon homme  :-P )
a son arrivée chez elle ...
( (

et la la fille elle rentre de son premier roulage
( (

ah et la future ex de mon homme avant sa rencontre avec le bitume ...

( (

et voila ..... :D  :D  :D  :D  :D
j'espere que mes images vont bien apparaitres  :-o

Edit by hurl: correction d'un lien
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 07 octobre 2006 à 10:01:51
Il est top ce tuono !
Titre: Re : Vos montures en photos
Posté par: Hurl le 09 octobre 2006 à 11:46:22
Ouaip, il est bien joli ce tuono special edition BMW (pour reglage des suspat électronique :-p) :lol:
Titre: Re : Vos montures en photos
Posté par: Guims le 09 octobre 2006 à 12:09:18
Voili Voilou  :-P

Titre: Re : Vos montures en photos
Posté par: vans le 09 octobre 2006 à 12:47:40

Hurl a écrit:
Ouaip, il est bien joli ce tuono special edition BMW (pour reglage des suspat électronique :-p) :lol:

j'sais pas pourquoi mais j'ai l'impression que tu te moques de moi la...... :cry:
ben voui ..... j'savais pas a quoi ca servait tous ces modes de reglage ou j'sais pas quoi .....
c'est la premiere fois que je dois sortir le manuel pour comprendre comment un tableau de bord fonctionne .... :-o  :D
Titre: Re : Vos montures en photos
Posté par: maya le 09 octobre 2006 à 13:02:43
ce modèle est magnifique.... j'ai flashé sur un modèle gris foncé à  un feu en pleine nuit.....oulouloulou, trop trop belle..... juste le temps de repérer le modèle .... elle était loin..... :cry:  :cry: ....

heu .. Maya..... ......gris foncé ...... ça va pas le faire hein .... pi la tienne .....elle est encore sous garantie.. pi c'est une bombe celle-ci.... pi un autre budget .....

mais qu'est ce qu'elle est belle...... :love:  :love:  :love:  :love:  :love:
Titre: Re : Vos montures en photos
Posté par: vans le 10 octobre 2006 à 08:42:30

maya a écrit:
ce modèle est magnifique.... j'ai flashé sur un modèle gris foncé à  un feu en pleine nuit.....oulouloulou, trop trop belle..... juste le temps de repérer le modèle .... elle était loin..... :cry:  :cry: ....

heu .. Maya..... ......gris foncé ...... ça va pas le faire hein .... pi la tienne .....elle est encore sous garantie.. pi c'est une bombe celle-ci.... pi un autre budget .....

mais qu'est ce qu'elle est belle...... :love:  :love:  :love:  :love:  :love:

 :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Viviane le 10 octobre 2006 à 17:56:47
;-)  ;-) la petite de la petite(

pas certaine que ce soit bon !!!! :-?
Titre: Re : Vos montures en photos
Posté par: Clochette le 10 octobre 2006 à 18:15:19

VIPI a écrit:
;-)  ;-) la petite de la petite(

pas certaine que ce soit bon !!!! :-?

bin oui c'est pas bon :D
Titre: Re : Vos montures en photos
Posté par: teuf le 20 octobre 2006 à 15:40:07
( (

edit Silent: correction du lien ;-)

re-edit: ah zut, z'avais po vu Invit-256 :D
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 20 octobre 2006 à 15:57:00

TEUF998 a écrit:
( (

Sylv1.....sort de ce corps..... :lol:  :lol:  :lol:  :lol:

Bon allez c'est pas le tout, mais faut que j'aille en week end.... :-P  :D
Titre: Re : Vos montures en photos
Posté par: Philippe le 20 octobre 2006 à 16:00:47

TEUF998 a écrit:
( (

Bon allez, je t'aide

( (

Mais c'est bien parceque t'es sage hein :lol:
Titre: Re : Vos montures en photos
Posté par: vans le 21 octobre 2006 à 20:25:36

et une autre de l'autre profile ...... :wg:
c'est faisable
Titre: Re : Vos montures en photos
Posté par: marco le 22 octobre 2006 à 09:49:37
Ayant vendu ma SVS650, je vais rouler pendant qq temps sur la moto de ma copine qui est un peu la mienne aussi :D


1999, 22000km

Opérations prévues à  plus ou moins long terme : pneus, plaquettes, durits avia, vidange fourche + huile 15, amortos Bitubo, protec carters carbone.

Ca sera déjà  pas mal :embarras:
Titre: Re : Vos montures en photos
Posté par: eldarin le 22 octobre 2006 à 11:59:15
La moto de sa cop pour faire de la piste, fallait y penser  :D  :D
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 22 octobre 2006 à 21:32:00

eldarin a écrit:
La moto de sa cop pour faire de la piste, fallait y penser  :D  :D

Titre: Re : Vos montures en photos
Posté par: marco le 23 octobre 2006 à 08:01:29
héhé pas con hein :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 23 octobre 2006 à 09:59:53
voui, mais 'faut quand même pas la casser sinon elle va être furax !! hihihi!!
Titre: Re : Vos montures en photos
Posté par: VFR01 le 23 octobre 2006 à 10:19:43

Silent Phong a écrit:
voui, mais 'faut quand même pas la casser sinon elle va être furax !! hihihi!!

+1 mode plus de grooooooooo calin powa  :-(   :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 23 octobre 2006 à 19:29:45

VFR01 a écrit:

Silent Phong a écrit:
voui, mais 'faut quand même pas la casser sinon elle va être furax !! hihihi!!

+1 mode plus de grooooooooo calin powa  :-(   :D  :D  :D

Oais mais a elle aussi ca va manquer  :D  :D

Enfin, ca dépend de marco, bien sur la piste, mais au lit??  :confused:

 :D  :D
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 23 octobre 2006 à 19:50:41
Pareil que sur la piste: il joue le chrono  :lol:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 23 octobre 2006 à 19:51:45

pizzai69 a écrit:
Pareil que sur la piste: il joue le chrono  :lol:

tant qu'il ne finit pas sur la pelouse.... :D  :lol:
Titre: Re : Vos montures en photos
Posté par: eldarin le 23 octobre 2006 à 19:53:06
Le pire, c'est quand il fait du hors piste, dans la boue  :D

C'est qu'il aura été surpris par le drapeau....rouge  :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: kali le 23 octobre 2006 à 19:56:53

eldarin a écrit:
Le pire, c'est quand il fait du hors piste, dans la boue  :D

C'est qu'il aura été surpris par le drapeau....rouge  :D  :D  :D  :D

PTDR  :lol:
Titre: Re : Vos montures en photos
Posté par: marco le 23 octobre 2006 à 20:20:51
Moi je serais plutà´t course d'endurance 8-)

Mais sans relais, parce que je vous vois venir  :D
Titre: Re : Vos montures en photos
Posté par: greg le 23 octobre 2006 à 20:30:02
Pour ceux qui l'aurai pas vu voila ma nouvelle

enfin je l'ai eu le 25 aout et déja 6000 KM  :-o
Titre: Re : Vos montures en photos
Posté par: knives_69 le 23 octobre 2006 à 23:16:30

greg a écrit:
Pour ceux qui l'aurai pas vu voila ma nouvelle

enfin je l'ai eu le 25 aout et déja 6000 KM  :-o

Déjà  vu...
Salaud de chanceux  ;-) .
Titre: Re : Vos montures en photos
Posté par: teuf le 23 octobre 2006 à 23:58:42

angel_aero a écrit:

et une autre de l'autre profile ...... :wg:
c'est faisable

oui mais arrive po a afficher image
Titre: Re : Vos montures en photos
Posté par: lezard le 24 octobre 2006 à 00:05:13

Voila mon bébé :-P , je l'ai acheté tout équipé :
- cuire sur le réservoire avec sacoche ventrale
- top caise
- alarme, cadenas, bloc disque
- et meme un peu personnalisée (embout valve et embout poignée bleu..)
Titre: Re : Vos montures en photos
Posté par: Rastaman le 27 octobre 2006 à 01:06:06
Bonsoir a tous voici ma monture avant qu'une caisse me coupe la route!!!!

GPZ 500S

Titre: Re : Vos montures en photos
Posté par: zigzigeur le 28 octobre 2006 à 16:28:24
ayet je suis de retour !! avec un ptit bandit de 2002 je suis revenu aux premiers amours !! lassé du svs et du 2 temps je laisse maintenant le plaisir du sv a ma cop's !!! voici une ptite photo de la belle !!  :D
je vais pouvoir revenir profier des balades hivernales !!
et à  cause de mon carton de janvier j'ai pris un peu de malus donc les sportives faut attendre !!!

la voici :
( (

j'ai changé de monture mais pas de combi !! toujours la combi yam sur une suz !!! :-o
Titre: Re : Vos montures en photos
Posté par: guillaume le 28 octobre 2006 à 19:07:17

zigzigeur a écrit:
lassé du svs et du 2 temps je laisse maintenant le plaisir du sv a ma cop's !!! voici une ptite photo de la belle !!  :D

Pourtant le SV par rapport au Bandit c'est quand même plus ludique nan? Ayant essayé un Bandit un jour, j'ai trouvé çà  asmathique et avard en sensation  :confused: M'enfin les goûts et les couleurs hein?!
Titre: Re : Vos montures en photos
Posté par: pierSVS le 30 octobre 2006 à 21:39:40
bonsoir a tous,

voici ma premiere monture.. et jen suis trés satisafait :D

il est de 99 et a 34 000KM

voici quelque photo..

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: pierSVS le 30 octobre 2006 à 21:46:43

pierSVS a écrit:
bonsoir a tous,

voici ma premiere monture.. et jen suis trés satisafait :D

il est de 99 et a 34 000KM

voici quelque photo..

( (

( (

( (

je comprend pas on voit pas les photos qui peu me dire comment faire???

Titre: Re : Vos montures en photos
Posté par: pizzai69 le 30 octobre 2006 à 21:53:08
Je peux le faire :D

En fait, ce forum est caractériel :lol:

Edite ton message, et mets en minuscules les balises IMG et URL ;-)
Titre: Re : Vos montures en photos
Posté par: kali le 31 octobre 2006 à 06:55:08
( (

( (

( (


Titre: Re : Vos montures en photos
Posté par: Ptitducky le 31 octobre 2006 à 08:54:50

kali a écrit:


Ben  :confused:  tu n'as pas eu un fazer aussi? :D

EDIT : dit donc...le gars qui t'a peint les jantes, il en a oublié un peu... :lol: seul 1/3 est peint en rouge :lol:
Titre: Re : Vos montures en photos
Posté par: ptitecox le 31 octobre 2006 à 10:21:57

Ptitducky a écrit:

kali a écrit:


Ben  :confused:  tu n'as pas eu un fazer aussi? :D

EDIT : dit donc...le gars qui t'a peint les jantes, il en a oublié un peu... :lol: seul 1/3 est peint en rouge :lol:

Et pi une div aussi :-)
Titre: Re : Vos montures en photos
Posté par: vans le 31 octobre 2006 à 12:52:53

TEUF998 a écrit:

angel_aero a écrit:

et une autre de l'autre profile ...... :wg:
c'est faisable

oui mais arrive po a afficher image

 :cry:  :cry:  :cry:  :cry:  :cry:  :cry:  :cry:  :cry:

si tu veux un coup de main ...... moi zveux la voir .....  :saut:
Titre: Re : Vos montures en photos
Posté par: ptiteguepe le 31 octobre 2006 à 12:54:39
Roooh z'avez pas vu la rubrique ?!? Mais non il s'est pas trompé !

C'est pas "Vos EX montures..", Mais.. "Vos montures..."

Alors c'est pas "une ex" mais une actuelle... ... enfin... si c'est quand même une "ex"... euuh... m'enfin bon... plus maintenant...

Vous voulez un dessin ?!?  :upset:
:lol:  :lol:

@Arno : cool, hein ?!? je rigole là  !!!
Titre: Re : Vos montures en photos
Posté par: kali le 31 octobre 2006 à 15:10:59
C'était juste un coup de main pour visualiser la mob de Piersv !

Perso jamais eu de moto rouge ni de sv   :D

A ptiteguepe :  trop fort l'officialisation publique :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: ptiteguepe le 31 octobre 2006 à 15:39:46
:lol:  :lol:  :lol:
Troop fort !!

Eh ben, ça au moins ... c'est fait !!

T'aurais pu me dire merci !  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: pierSVS le 31 octobre 2006 à 17:50:38

kali merci pour ton coup de main..  :-)

ps: la couleur est orange mais comme c est pris d un portable ce n est pas trés net..
Titre: Re : Vos montures en photos
Posté par: cardi le 31 octobre 2006 à 21:15:39
Voici la mienne que j'ai depuis aout 2006


Titre: Re : Vos montures en photos
Posté par: badboy69 le 01 novembre 2006 à 14:10:07

cardi a écrit:
Voici la mienne que j'ai depuis aout 2006



 :love:  :love:  :love: Elle est magnifique!!
Je l'est mis sur mon bureau 8-)  8-)

Au faite si tu voit un pti gars scoot avec un blouson Jaune/noir et casque shark et qui te fait de grand signe(2 bras en l'air en faisant coucou :lol:  :lol: )
C'est moi!! :D  :D
Titre: Re : Vos montures en photos
Posté par: cardi le 01 novembre 2006 à 17:16:09

badboy69 a écrit:

cardi a écrit:
Voici la mienne que j'ai depuis aout 2006



 :love:  :love:  :love: Elle est magnifique!!
Je l'est mis sur mon bureau 8-)  8-)

Au faite si tu voit un pti gars scoot avec un blouson Jaune/noir et casque shark et qui te fait de grand signe(2 bras en l'air en faisant coucou :lol:  :lol: )
C'est moi!! :D  :D

Merci badboy ;-)
Et puis je réponds aux scoot qui me disent bonjour :moto1:
Titre: Re : Vos montures en photos
Posté par: mcflyom le 02 novembre 2006 à 14:59:01
Mon meilleur pote à  la même mais la version 2005 avec une peinture perso... ;-)

+1 pour le vert poussif :lol:
Titre: Re : Vos montures en photos
Posté par: le 05 novembre 2006 à 16:31:51
voila ma becane!(si j'arrive a mettre la photo)
( (

edit Silent: correction du lien (le forum ne supporte pas les lettres majuscules!)
Titre: Re : Vos montures en photos
Posté par: le 14 novembre 2006 à 03:09:41
la petite de 3/4 arrière...


... et de 3/4 avant ... mon srad 600 de 99 avec 54000km et tous ses chevaux! Voire plus... 106cv au banc on n'est pas si loin des nouvelles r6 et gsxr k6 finallement...

Silencieux MIVV, amorto reconditionné, 14 dents à  la sortie, cales chapeaux carb envolées, supercorsa sc1 AV et sc2 AR et voili, en piste... c'est un peu lourd mais ça me va...

Titre: Re : Vos montures en photos
Posté par: Manu le 17 novembre 2006 à 00:35:54



Titre: Re : Vos montures en photos
Posté par: lénaïc le 17 novembre 2006 à 19:25:16
et v'la pour mon ZX9R de 99:

Titre: Re : Vos montures en photos
Posté par: Claude le 19 novembre 2006 à 15:32:38
Et bien pour continuer voici mes bécanes:

Honda VTR SP2 Castrol réplica:


Honda VTR SP2 Laguna Seca réplica:


Bimota SB8K Santamonica:

Titre: Re : Vos montures en photos
Posté par: c'est pas vrai, réel c'est pas mon nom! le 19 novembre 2006 à 16:35:10
ma petite motobylette avec mes amours dessus  (il en manque une :tazette)


et la bicyclette toute seule :


Titre: Re : Vos montures en photos
Posté par: pizzai69 le 19 novembre 2006 à 16:58:27
Bimota a copié les jantes de mon CB  :roll:

 :D Belles machines cloclo  :-o
Titre: Re : Vos montures en photos
Posté par: sphinx le 19 novembre 2006 à 17:41:01

Claude a écrit:
Et bien pour continuer voici mes bécanes:

Honda VTR SP2 Castrol réplica:

Honda VTR SP2 Laguna Seca réplica:

Bimota SB8K Santamonica:


je veux les memes !!!! surtout la SB8K !!!!

Titre: Re : Vos montures en photos
Posté par: no69 le 20 novembre 2006 à 20:30:10
ma 2éme hornet

mon cbr

mon 1er gex
Titre: Re : Vos montures en photos
Posté par: Tonyo le 20 novembre 2006 à 20:54:23

eldarin a écrit:
Sympas ton Fz1  :-)

Par contre t'as fait une faute de frappe : on dit pas ducat c'est de la bonne, mais belle moto ! Parceque sinon, demande a toto   :D

Elle roule très bien ma Ducat...  8-)


Bien propre ton SV Atok
On dirait tonyo mais en tout petit

Oui ça faisait plus pocket avec moi !!! :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 21 novembre 2006 à 11:24:55

Tonyo a écrit:

Bien propre ton SV Atok
On dirait tonyo mais en tout petit

Oui ça faisait plus pocket avec moi !!! :D

Exact !!!
Regardez moi ce grand gognian qui ne sait plus o๠mettre ses cannes et qui sort le genou du mauvais coté !!!!

Titre: Re : Vos montures en photos
Posté par: vans le 21 novembre 2006 à 13:01:01

Claude a écrit:
Et bien pour continuer voici mes bécanes:

Honda VTR SP2 Castrol réplica:

Honda VTR SP2 Laguna Seca réplica:

Bimota SB8K Santamonica:

nan mais c'est tout ...... ah y'en a ils se font plaise  
ouh le vilain garcon ...... au fait Claude .... t'auras droit a ta tapette quand meme :-P
Titre: Re : Vos montures en photos
Posté par: Sam le 23 novembre 2006 à 10:55:37
La période Ducati, très courte :-(, s'est terminée... temporairement !

Alors je vous présente ma machine à  laver... (cette fois c'est pas une blague ( Pour le moment j'ai pas testé le programme Essorage... chais pas si je le testerais un jour :roll:

(photo de l'ancien proprio, j'vous posterais une photo actualisée ce we)

oui oui c'est un 4cylindres :-o :-o :-o

faut bien tester d'autres trucs dans la vie (mais je pense que je préfère les bicylindres quand même).

PS : je sais pour la déco...  :-P
Titre: Re : Vos montures en photos
Posté par: kali le 23 novembre 2006 à 11:11:23
Ben alors féloches et n'oublies pas de mettre de l'huile  :lol:
Titre: Re : Vos montures en photos
Posté par: airpébé le 23 novembre 2006 à 11:13:25
enfin une qui a compris que 4 cylindres c'est mieux que deux  :lol:  :lol:  :lol:

félicitation  à  toi ,c'est vrai que la déco est pas top
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 23 novembre 2006 à 11:18:56
mais pourquoi il a une peinture de gex ?????? :lol:
Titre: Re : Vos montures en photos
Posté par: guillaume le 23 novembre 2006 à 12:08:32

Sam a écrit:


Cà  déchire les R1 première génération.  8-) Je sens que tu vas un peu te la péter au feu rouge  :D Ahhhhhhhhh, L'electroménager nippon, y'a que çà  de vrai !  :lol:
Titre: Re : Vos montures en photos
Posté par: cool_eyer le 23 novembre 2006 à 12:10:19
Quelle horrrrrrrrrrreur !

EDIT : PAS LA MOTO ! Mais l'abandon de ta superbe moto !

Pourquoi t'as plus ta ducati ?
Titre: Re : Vos montures en photos
Posté par: VFR01 le 23 novembre 2006 à 12:11:38
:-o félicitation Sam  :D c'est pà¢s toi qui disais moi sur un 4 cylindre et patati et patata... :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: guillaume le 23 novembre 2006 à 12:13:57

cool_eyer a écrit:
Quelle horrrrrrrrrrreur !

Pourquoi t'as plus ta ducati ?

Une Traban de 1962 était plus fiable apparemment que son 2 roues  :D
Titre: Re : Vos montures en photos
Posté par: Sam le 23 novembre 2006 à 12:18:25
oui oui je sais pour la déco moche

donc soit repeinture (full black), soit je trouve des carénages origine pas chers mais pour le moment elle va rester comme ça... j'espère que ça fera fuir les voleurs au moins...


guillaume a écrit:
Cà  déchire les R1 première génération.  8-)
ça pousse grave !!! :-o


VFR01 a écrit:
:-o félicitation Sam  :D c'est pà¢s toi qui disais moi sur un 4 cylindre et patati et patata... :D  :D  :D  :D

nan mais je reste convaincue que les bicylindres me conviennent mieux. mais les modèles que je veux restent encore inaccessible tant à  l'achat qu'à  l'entretien :D (ceci dit, une hypersport 1000 c'est pas donné non plus en entretien).
Titre: Re : Vos montures en photos
Posté par: TITIZ69 le 23 novembre 2006 à 12:23:36
Felicitations Sam :pouces:

T as période TCL fut courte  :D
Titre: Re : Vos montures en photos
Posté par: knives_69 le 23 novembre 2006 à 23:27:34
Je dois avoir des goûts de chiotte, je trouve le coloris original, j'aime bien  :D .
Titre: Re : Vos montures en photos
Posté par: Clochette le 23 novembre 2006 à 23:30:34

knives_69 a écrit:
Je dois avoir des goûts de chiotte, je trouve le coloris original, j'aime bien  :D .

bin je me faisais la même remarque :roll:
Titre: Re : Vos montures en photos
Posté par: greg le 24 novembre 2006 à 21:23:52
Félicitations et fais gaffe avec la poigné de gaz  :D
Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 24 novembre 2006 à 21:59:46
Sam sur une mille ... c'te classe !!! (
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 25 novembre 2006 à 00:24:00
mmmmmhhh...  :confused:
j'y croirais quand je verrai Sam sur sa moto... elle a dejà  essayé de nous faire croire qu'elle montait un R1 !

Saaaam ?
Tu confirmes le R1 ?
Titre: Re : Vos montures en photos
Posté par: Sam le 25 novembre 2006 à 09:43:16

greg a écrit:
Félicitations et fais gaffe avec la poigné de gaz  :D
oui :D


Ragedvaincre a écrit:
Sam sur une mille ... c'te classe !!! (
hé hé hé...


lefalconoir a écrit:
mmmmmhhh...  :confused:
j'y croirais quand je verrai Sam sur sa moto... elle a dejà  essayé de nous faire croire qu'elle montait un R1 !

Saaaam ?
Tu confirmes le R1 ?
mais siiiii c'est vrai, j'ai un R1 moche ! lol
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 25 novembre 2006 à 10:29:29

Sam a écrit:

greg a écrit:
Félicitations et fais gaffe avec la poigné de gaz  :D
oui :D


Ragedvaincre a écrit:
Sam sur une mille ... c'te classe !!! (
hé hé hé...


lefalconoir a écrit:
mmmmmhhh...  :confused:
j'y croirais quand je verrai Sam sur sa moto... elle a dejà  essayé de nous faire croire qu'elle montait un R1 !

Saaaam ?
Tu confirmes le R1 ?
mais siiiii c'est vrai, j'ai un R1 moche ! lol

moi j'l'aime bien ton moins t' es original...Et c pas si moche que cA..

apres bienvenue sur une vrai moto qui tient la route et qui demarre a chaque fois....

une vrai sportive maintenant la chef....!!!!

ps: a quand un wheel sur 50m au feux rouge ? :lol:
Titre: Re : Vos montures en photos
Posté par: Sam le 25 novembre 2006 à 11:31:55
Sylv1 a écrit:
apres bienvenue sur une vrai moto qui tient la route et qui demarre a chaque fois....
nan la ducat démarrait mieux et plus souvent :roll:

ps: a quand un wheel sur 50m au feux rouge ? :lol:
 :-P  :-P  :-P
Titre: Re : Vos montures en photos
Posté par: eldarin le 25 novembre 2006 à 12:14:10
Superbe sam !

Vivement la piste !  :-)
Titre: Re : Vos montures en photos
Posté par: cuarved le 25 novembre 2006 à 13:32:20

Silent Phong a écrit:
mais pourquoi il a une peinture de gex ?????? :lol:

C'est pour aller plus vite :D
A moins que ce soit pour tromper l'ennemi  :lol:

En tout cas félicitations
les futurs chronos sur piste ;-)
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 26 novembre 2006 à 22:24:03
Saaaam ?
Tu confirmes le R1 ?[/quote]mais siiiii c'est vrai, j'ai un R1 moche ! lol[/quote]

Désolé Sam, j'ai douté c'est pas bien...  :roll:  donc...  BRAVO !

apres bienvenue sur une vrai moto qui tient la route et qui demarre a chaque fois....
Mesquin avec les bicylindres çui-ci... pfffff...  :D
Titre: Re : Vos montures en photos
Posté par: Sam le 27 novembre 2006 à 07:36:39
lol :D

sinon en preuve en image, avec moi dessus :

Titre: Re : Vos montures en photos
Posté par: le 27 novembre 2006 à 09:23:17
C'est vrai que c'est original comme déco !

Féloches sam ! a trés bientot sur piste alors ! ;-)
Titre: Re : Vos montures en photos
Posté par: phil_69 le 27 novembre 2006 à 15:46:51
trés jolie R1 SAM, felicitation, j'en connais plus d'un qui vont ce faire mettre des tours avec sa ... lol

Bon sinon me concernant vu que j'ai que ma bibiche je vais vous mettre les photos de la base (a l'achat) jusqu'au modif que j'ai fait:

Donc la voila a l'achat :

( (
( (

dés l'achat je voulais l'équipé, donc sabot, bulle, passage de roue, leche roue.

Ensuite et venu le new guidon, un Tommaceli (origine VOXAN street scrambler) accompagné d'un ptit silencieux LeoVince :

( (
( (

voila ensuite j'ai changé les retro et j'en ai mis un seul :

( (

Et aprés cela est venu mon accident, version officielle une voiture qui ma coupé la route, officieuse, la roue arriere et partie d'un coup a gauche en plin wheel  le resultat,
un guidon, levier de frein, pedale de frein, reservoir poké, silencieux rapé et carter droit aussi :

( (

Donc aprés cela, envoie du reservoir en peinture, changement guidon pour mettre un afam titan, par main, changement pedale de frein et levier de frein, restauration silencieux :

( (
( (

aprés cela derniere modif effectuée c'est la mise en place d'une plaque phare acerbis :

( (

voila, les dernieres modif a faire, sont changement du silencieux, je suis en train d'en fair eun plus petit en carbone, et remise en place du sabot qui est en peinture.....
Titre: Re : Vos montures en photos
Posté par: eldarin le 03 décembre 2006 à 14:30:09
Ayé, a fait quelques tofs de ma miss en tenue de ville.

Quand le poly sera en place, je referais des toffs dans son costume de scene!




Titre: Re : Vos montures en photos
Posté par: sphinx le 03 décembre 2006 à 15:03:14
rhoooo !!! elle est tros belle !!!! :love: :love: :love: :love: :love: :love: :love: :love:

j'veux la meme pour noel !!!!!!  :D
Titre: Re : Vos montures en photos
Posté par: StephMaha le 03 décembre 2006 à 16:12:45

sphinx a écrit:
rhoooo !!! elle est tros belle !!!! :love: :love: :love: :love: :love: :love: :love: :love:

j'veux la meme pour noel !!!!!!  :D

clair, il s'est fait plaisir le saloupiau ...  :D  :D  :D  Elle est belle !!!

Quel est le boulet qui a encore mis des posters sur la page d'avant !!!  :upset:


 :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: sphinx le 03 décembre 2006 à 18:45:33

StephMaha a écrit:

sphinx a écrit:
rhoooo !!! elle est tros belle !!!! :love: :love: :love: :love: :love: :love: :love: :love:

j'veux la meme pour noel !!!!!!  :D

clair, il s'est fait plaisir le saloupiau ...  :D  :D  :D  Elle est belle !!!

Quel est le boulet qui a encore mis des posters sur la page d'avant !!!  :upset:


 :D  :D  :D

j'voudrais pas balance mais je crois que c'est phil ...  :-P  :D
Titre: Re : Vos montures en photos
Posté par: le 03 décembre 2006 à 19:57:27
Phil, ta moto est magnifique... enfin... était! :D

El darin, je suis amoureux (pas de toi, rassures toi :D ), je l'étais déjà  avant, mais j'avais jamais vu le modèle 2007 :-o
Titre: Re : Vos montures en photos
Posté par: Sam le 03 décembre 2006 à 20:43:41
les posters ont été réduits... :roll:

vivement les photos du gex préparé piste ;)
Titre: Re : Vos montures en photos
Posté par: le 04 décembre 2006 à 11:03:44
TERRIBLE eldarin ton gex !!!!!!!!!!
Titre: Re : Vos montures en photos
Posté par: eldarin le 04 décembre 2006 à 12:59:52

Sam a écrit:
les posters ont été réduits... :roll:

vivement les photos du gex préparé piste ;)

A ce propos, j'ai juste regardé pour enlever l'arriere, et mettre le poly, et remettre le carénage origine.

J'ai fait toute la manipe en 35 min...  :-o  Trop facile , tout a été tres bien pensé !

Je pense que pour l'avant se sera plus compliqué.
Titre: Re : Vos montures en photos
Posté par: ninja6 le 04 décembre 2006 à 13:12:27
oula mon darin que tu es rapide  :D

tu l'as acheter ou ton poly ma poule faut que j'en achete un moi et parès faut le peindre     hihihi!!!!!!!
Titre: Re : Vos montures en photos
Posté par: VFR01 le 04 décembre 2006 à 13:13:11
magnifique ce gex Eldarin  :love:  :love:  :love:  :love: j'ai hate de la voir avec ses habits de piste  :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 04 décembre 2006 à 19:06:24

ninja6 a écrit:
oula mon darin que tu es rapide  :D

tu l'as acheter ou ton poly ma poule faut que j'en achete un moi et parès faut le peindre     hihihi!!!!!!!

Sebi moto  :-)

Rien a dire, de la super came !

Je suis passé par suz... Rien a voir avec du poly y  a pas photo !!

Il est blanc, bien nikel! Je voulai le repeindre, mais ca va faire juste au niveau tune..  :-(

Une fois monté, j'aviserai. Vu que les jantes, le cadre etc son noirs, ca rend pas mal !! Un peu comme le speed ! Juste un autocollant ou deux avec Le GSXR d'origine et hop, ca rendra finalement bien !  :-)
Titre: Re : Vos montures en photos
Posté par: philippe le 06 décembre 2006 à 13:28:55
Allez va ! ma moulinette japonaise comme disent certains... mais du couple à  revendre quand même et une belle gueule de moto ! :D

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 06 décembre 2006 à 13:32:41

eldarin a écrit:
blableblibloblu..., ca rend pas mal !! Un peu comme le speed !

mouais bof...  :D c'est un peu moins beau quand même  8-)  :D
Titre: Re : Vos montures en photos
Posté par: eldarin le 06 décembre 2006 à 15:57:37

Silent Phong a écrit:

eldarin a écrit:
blableblibloblu..., ca rend pas mal !! Un peu comme le speed !

mouais bof...  :D c'est un peu moins beau quand même  8-)  :D

Surtout le bruit et le couple qui manque  :-(
Titre: Re : Vos montures en photos
Posté par: Hurl le 07 décembre 2006 à 16:08:40
Féloche eldarin, mais tu connais la tradition : :pint: :pint: :lol:
Titre: Re : Vos montures en photos
Posté par: Clochette le 07 décembre 2006 à 16:31:47

bonaweb a écrit:
Allez va ! ma moulinette japonaise comme disent certains... mais du couple à  revendre quand même et une belle gueule de moto ! :D

C'était avant ou après que tu lises le mode d'emploi de la béquille....

trop tard je suis déjà  loin... :roll:
Titre: Re : Vos montures en photos
Posté par: philippe le 07 décembre 2006 à 16:49:43

Clochette a écrit:

bonaweb a écrit:
Allez va ! ma moulinette japonaise comme disent certains... mais du couple à  revendre quand même et une belle gueule de moto ! :D

C'était avant ou après que tu lises le mode d'emploi de la béquille....

trop tard je suis déjà  loin... :roll:


au moins moi j'en ai une...  :D

ps : c'était avant... et toute façon y'a aucune différence avec après  :-P
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 07 décembre 2006 à 18:08:26

bonaweb a écrit:
au moins moi j'en ai une...  :D

heyy clochette!! ramasses tes dents :freak: :lol:
Titre: Re : Vos montures en photos
Posté par: Clochette le 07 décembre 2006 à 18:16:15

Silent Phong a écrit:

bonaweb a écrit:
au moins moi j'en ai une...  :D

heyy clochette!! ramasses tes dents :freak: :lol:

Méchant modo :upset:
Titre: Re : Vos montures en photos
Posté par: Slash le 09 décembre 2006 à 20:03:14
et voila ^^
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 09 décembre 2006 à 22:01:30
Et bien tu t'es bien fait plaisir là  :pouces:
Beau remplaçant de ton SS :D
Titre: Re : Vos montures en photos
Posté par: airpébé le 09 décembre 2006 à 22:16:34
tu aurais pu attendre un peu et prendre un 1098 !!!!!!!!!!

mais bon deja une bonne bécanne à  mécaniquer   :lol:  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Kokito le 09 décembre 2006 à 22:49:35
Magnifique bécane Slash  :D

Ducati en force  :-P
Titre: Re : Vos montures en photos
Posté par: tchoutch le 09 décembre 2006 à 23:47:51

Slash a écrit:
et voila ^^

Titre: Re : Vos montures en photos
Posté par: pizzai69 le 10 décembre 2006 à 12:09:50

tchoutch a écrit:

Ouais mais je l'aurais prise aux 1/8e moi, parceque la c'est encombrant dans le garage :D
Titre: Re : Vos montures en photos
Posté par: cool_eyer le 11 décembre 2006 à 10:06:44
Non seulement elle est sublimement belle, mais en plus c'est une incroyable monture : ça freine comme pas la peine, c'est totalement rigide, vif, le moteur prends des tours comme un malade...

C'est the chrono's killer...
Titre: Re : Vos montures en photos
Posté par: VFR01 le 11 décembre 2006 à 10:13:35
belle monture en effet  :10:
Titre: Re : Vos montures en photos
Posté par: Stephane le 18 décembre 2006 à 21:41:38

Et 1 blutch sur la mienne !
Titre: Re : Vos montures en photos
Posté par: Kinderbeno le 18 décembre 2006 à 22:13:01
aller nicho finit vite ton rodage, que je puisse l'essayer  :D
toi ti mon coupin  :wg:
Titre: Re : Vos montures en photos
Posté par: le 19 décembre 2006 à 13:33:36
C'est vrai qu'elles sont belles ces ducat :love:
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 19 décembre 2006 à 15:45:52
m ouais ca reste un DUCAT , un gros treteau qui tombe en panne et a 1000€ la revision....

Titre: Re : Vos montures en photos
Posté par: Thomas ARMAND le 19 décembre 2006 à 16:54:13

Sylv1 a écrit:
m ouais ca reste un DUCAT , un gros treteau qui tombe en panne et a 1000€ la revision....

Ah Sylvain !!!!

Jeune padawan, un jour tu comprendras qu'une Ducat c'est autre chose qu'un mixer..., un jour tu comprendras...

Enfin, je commence à  émettre des doutes sur tes facultés intellectuelles pour mener à  bien une analyse factuelle (trop fort) !!   :-o

Ca va que tu sors de la même école que moi  !!! :D

Titre: Re : Vos montures en photos
Posté par: lefalconoir le 19 décembre 2006 à 19:25:36
Moi j'ai pà´ de doutes !

D'ailleurs il a refait toute sa cuisine pour mieux exposer ses mixers...
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 20 décembre 2006 à 07:23:39

lefalconoir a écrit:
Moi j'ai pà´ de doutes !

D'ailleurs il a refait toute sa cuisine pour mieux exposer ses mixers...

qu'est qu'y dit l'alcoolique ??  :lol:  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 20 décembre 2006 à 19:37:47
Chuis pas alcoolique moi !
La preuve : pas de problème avec les escaliers...
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 20 décembre 2006 à 19:56:41

lefalconoir a écrit:
Chuis pas alcoolique moi !
La preuve : pas de problème avec les escaliers...

j crois que tu t'es pas vue sur le tapis de dance samedi soir ...

on aurait du prendre des photos !! :lol:  :lol:  :lol:

ps: quel escalier ?
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 20 décembre 2006 à 20:01:59

Sylv1 a écrit:
ps: quel escalier ?

j'ai encore la video sur mon PC...tu veux que je la remette en ligne pour te remémorer ta soirée? :D  :lol:
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 20 décembre 2006 à 20:08:00

Ptitducky a écrit:

Sylv1 a écrit:
ps: quel escalier ?

j'ai encore la video sur mon PC...tu veux que je la remette en ligne pour te remémorer ta soirée? :D  :lol:

mytho... :lol:  :D
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 21 décembre 2006 à 18:05:42
Quel tapis de danse... ?

Titre: Re : Vos montures en photos
Posté par: Slash le 22 décembre 2006 à 01:01:19
Je ne dirais qu une chose : elle est belle la R1 dessinée sur le logo LMV3 en haut a gauche.. .n est il pas...?

Sans doute un signe ^^
Titre: Re : Vos montures en photos
Posté par: lefalconoir le 23 décembre 2006 à 22:13:41
O๠çà  un R1 ?
Tu parles du Lyon Motard V3 n'est-il pas ? Pas vu...

Ceci dit... j'ai vu passer une tite brune avec un gros R1 bleu et blanc il y a deux semaines en bas de chez moi... elle est pas mal en vrai cette meule !
Titre: Re : Vos montures en photos
Posté par: le 26 décembre 2006 à 21:06:47
C'est pas une ducat' supersport mais bon...

Titre: Re : Vos montures en photos
Posté par: pizzai69 le 26 décembre 2006 à 21:41:31
Moi en ce moment ca ressemble à  ca  :lol:

( (
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 26 décembre 2006 à 21:49:50
@ pizza : tu fais tes travaux dans la cave à  momo ? :D

est il possible de savoir les modifs que tu fais dessus?
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 26 décembre 2006 à 22:13:11
C'est pas la cave a momo c'est le sous sol commun de l'immeuble que j'envahi :lol:

Principalement je change les spy de fourche et le cable de retour de gaz ... enfin j'ai pas encore récuperé les pieces neuves :D

Donc au passage, j'en profite pour poncer mes fourreaux de fourche et les remettre un peu a neuf (ils ont plein d'impacts de je ne sais quoi, mais en 55 000km je les comprend).
Voila ce que ca donne en gros (avant et apres renovation):
( (
J'ai poncé a l'eau, au 180 puis 240, 400, et enfin 600. Apres ca on peut passer de la paille de fer + belgom pour une finition polie, mais ca me plait pas, je prefere comme ca.

J'en profite aussi pour faire un gros nettoyage en profondeur (graise de partout autour du kit chaine + graviers collé, "poussiere" sur le haut moteur etc...).
Tant que c'est démonté, petite révision avec nettoyage des filtres, bougies, graissage des cables (difficil l'acces sur les carbus  :mad: ), enfin tout les petits trucs que je verrais a faire (par exemple j'ai découvert que mes durits de reniflard et mise a l'air libre de réservoir n'etaient pas branchées  :D ; ainsi que le reniflard de la boite a air, ce qui fait que l'huile qui redescend dans la boite a air coule directement sur mon moteur au niveau du cache PSB  :mad: ).

Autre petite chose, j'ai (enfin  :lol:  :lol: ) coupé mon guidon pour plus qu'il dépasse de chaque coté de mes poignées (que je change au passage), parceque j'en ai marre de shooter les rétros des bagnoles, je sais plus ou me fouttre apres  :lol:  :D

Enfin, j'ai tombé le pot et les platines pour m'ateler a l'adaptation de ma panoplie de pistard du dimanche  :D

Voila, c'est tout  :-)  :D
Titre: Re : Vos montures en photos
Posté par: Sam le 26 décembre 2006 à 22:55:03
pizzai, si tu veux, fais un topic dans la section mécanique pour le suivi des modifs ;)
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 26 décembre 2006 à 23:03:53
Je vais voir ok :-)
Titre: Re : Vos montures en photos
Posté par: sphinx le 27 décembre 2006 à 00:30:47
bon courage !!!

ca va etre une tondeuse toute neuve aprés !!! :lol2: :D

ps: si ta besion d'aide pour bricoler...  ;-)
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 27 décembre 2006 à 07:43:07
Non ca va aller :-)

En fait les spy c'est tout simple. Le reste c'est des petits trucs que je fais a la pause de midi ou le soir en rentrant du boulot.
Titre: Re : Vos montures en photos
Posté par: badboy69 le 27 décembre 2006 à 18:47:21
pour ceux qui connaisse pas l'effet Zest.
Descriptif: vieux (95)
- un avant trop laid
- Peu servir de camion avec mes 2 coffres
- a 2 c'est confortable
- et prévoir un bon tournevis pour pouvoir accédé au moteur ( 15 vis inside :D )

Bon mes photo date un peu car maintenant j'ai plus de rétro a cause d'un blocage de roue sur le rond point a coté du ciné cité,l'optique tout griffé il tombé contre un mur au lycée( :upset: )

p.s: j'ai oublier...mes roues..c'est du 10 pouces.... :lol:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 27 décembre 2006 à 19:17:49
les liens ne marchent po...

ayé marche :D

PS : faut bien commencer par quelque ton top case permet au moins d'apporter les bieres pour les soirées.... :D
Titre: Re : Vos montures en photos
Posté par: badboy69 le 27 décembre 2006 à 19:36:52
Je vient juste de les tester et sa marche chez moi!
Titre: Re : Vos montures en photos
Posté par: sphinx le 28 décembre 2006 à 01:01:20
désolé pour cette remarque mais je me sens obliger... :

qu'es ce que c'est moche ... :lol2:

mais comme dit le canard faut bien commencer par quelque chose...

moi ce fut sur ce magnifique Fox (  8-)

Titre: Re : Vos montures en photos
Posté par: ninja6 le 28 décembre 2006 à 08:29:45

sphinx a écrit:
désolé pour cette remarque mais je me sens obliger... :

qu'es ce que c'est moche ... :lol2:

mais comme dit le canard faut bien commencer par quelque chose...

moi ce fut sur ce magnifique Fox (  8-)


une asperge là -dessus !!!eh ben tu devais être beau dis donc     :D  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 28 décembre 2006 à 08:34:29

sphinx a écrit:moi ce fut sur ce magnifique Fox (  8-)

c'est fou a quel point je trouve ridicule de mettre un pot ninja (qui doit valoir le prix de la mob) sur un scooter pour grand mere qui va chercher les poireaux le samedi matin au marché.....  :lol:  :lol:  :D
Titre: Re : Vos montures en photos
Posté par: knives_69 le 28 décembre 2006 à 10:53:29

Ptitducky a écrit:

sphinx a écrit:moi ce fut sur ce magnifique Fox (  8-)

c'est fou a quel point je trouve ridicule de mettre un pot ninja (qui doit valoir le prix de la mob) sur un scooter pour grand mere qui va chercher les poireaux le samedi matin au marché.....  :lol:  :lol:  :D

Ne ferais tu pas allusion au pot rémus de sa div qui coûte la moitié du prix de la moto tout sa pour une meule qui plafonne à  140 en fesant un barrouf du diable alors qu'au dessus de 6000tr il ne se passe plus rien?
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 28 décembre 2006 à 10:57:46
Bah vi, 'faut bien commencer par quelque chose :D ... j'ai même pas eu ça étant ado :D

Juste une vieille 103 avec turbo bricolé en compagnie de mon cousin à  l'aide d'un sèche cheveu :D .... et bah figurez vous que cela n'a jamais fonctionné :lol: !!!!!!!!!!!
Titre: Re : Vos montures en photos
Posté par: maya le 28 décembre 2006 à 10:59:41

knives_69 a écrit:

Ptitducky a écrit:

sphinx a écrit:moi ce fut sur ce magnifique Fox (  8-)

c'est fou a quel point je trouve ridicule de mettre un pot ninja (qui doit valoir le prix de la mob) sur un scooter pour grand mere qui va chercher les poireaux le samedi matin au marché.....  :lol:  :lol:  :D

Ne ferais tu pas allusion au pot rémus de sa div qui coûte la moitié du prix de la moto tout sa pour une meule qui plafonne à  140 en fesant un barrouf du diable alors qu'au dessus de 6000tr il ne se passe plus rien?

rhooooooooooooo......mais c'est po fini tous les 2 de vous en prendre à  Sphynx de cette façon .... :mad:  :mad:  :mad: .. bande de meuuuchants va....  :upset:  :upset:  :upset: ....

"Robin des bois" qui ressort entre les fêtes .... la défense du petit, de l'opprimé ....  hihihihi.... pas taper Sphynx..... ;-)
Titre: Re : Vos montures en photos
Posté par: badboy69 le 28 décembre 2006 à 11:11:42

sphinx a écrit:
désolé pour cette remarque mais je me sens obliger... :

qu'es ce que c'est moche ... :lol2:

mais comme dit le canard faut bien commencer par quelque chose...

moi ce fut sur ce magnifique Fox (  8-)


 :lol:  :lol:
En tout cas,on ne peut pas me louper :D

et dire mon équipement(casque,gant,blouson) vaut 1fois 1/2 plus cher que mon scoot :-P
Titre: Re : Vos montures en photos
Posté par: badboy69 le 28 décembre 2006 à 11:14:18

Ptitducky a écrit:
PS : faut bien commencer par quelque ton top case permet au moins d'apporter les bieres pour les soirées.... :D

Et encore!!!Peu meme ramené les pti gateau,le ricard,le wisky,le coca,......le bar en faite :D
Titre: Re : Vos montures en photos
Posté par: sphinx le 28 décembre 2006 à 17:02:29

knives_69 a écrit:

Ptitducky a écrit:

sphinx a écrit:moi ce fut sur ce magnifique Fox (  8-)

c'est fou a quel point je trouve ridicule de mettre un pot ninja (qui doit valoir le prix de la mob) sur un scooter pour grand mere qui va chercher les poireaux le samedi matin au marché.....  :lol:  :lol:  :D

Ne ferais tu pas allusion au pot rémus de sa div qui coûte la moitié du prix de la moto tout sa pour une meule qui plafonne à  140 en fesant un barrouf du diable alors qu'au dessus de 6000tr il ne se passe plus rien?




Maya a écrit:
rhooooooooooooo......mais c'est po fini tous les 2 de vous en prendre à  Sphynx de cette façon ....    .. bande de meuuuchants va....    ....

"Robin des bois" qui ressort entre les fêtes .... la défense du petit, de l'opprimé .... hihihihi.... pas taper Sphynx.....

merki grand mere maya (:lol:) de prendre ma defense face a ces mechants tout pas beau !!! :lol2: :D
Titre: Re : Vos montures en photos
Posté par: knives_69 le 28 décembre 2006 à 18:18:26

sphinx a écrit:


C'est marrant je crois que j'ai vu ça là  ("e_only=0&new=0&nojs=0#t14739765).
Quel plagiat honteux...
Titre: Re : Vos montures en photos
Posté par: Christian le 07 janvier 2007 à 15:50:51
Dans la foulée de mon arrivée, voici ma bête, aussi dans les albums. :-)
J'en profite pour dire que je trouve dommage de ne pouvoir uploader des images de plus 1024x1024. Je comprends qu'il peut y avoir des raisons techniques, mais d'autres forums admettent des images plus importantes. 1024x1024, on ne shoot plus à  ce format.

Bon, j'arrive pas à  insérer d'image, si qq'un peut m'aider!!!
Titre: Re : Vos montures en photos
Posté par: Christian le 07 janvier 2007 à 17:22:08
Nouvelle tentative
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 07 janvier 2007 à 18:21:32
La solution c'est de mettre une miniature, comme ca tout le monde est content.
Titre: Re : Vos montures en photos
Posté par: tchounet le 09 janvier 2007 à 23:17:14
Bon j'essaie de mettre une photo mais j'ai pas tout compris alors on verra bien

Titre: Re : Vos montures en photos
Posté par: ninja6 le 09 janvier 2007 à 23:28:09
Eh ZEDDDDDDDDDD    il y en a des pièces pour toi  ça viens d'arriver  !!!!!!!!!!!! :D  :D  :D  :D  :D  :D  :lol:  :lol:  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: le 09 janvier 2007 à 23:38:44
Ooooo un DDE team ! c'est beau! :-)
Titre: Re : Vos montures en photos
Posté par: tchounet le 10 janvier 2007 à 08:08:16
Eh ZEDDDDDDDDDD il y en a des pièces pour toi ça viens d'arriver !!!!!!!!!!!!          

et vii mais sauf que ça c'était avant mon superbe croutage à  Issoire alors les pièces c'est plutot moi qui vais les piquer à  Zedddddddd  :D  :D  :lol:   :lol:
Titre: Re : Vos montures en photos
Posté par: ZedMed le 10 janvier 2007 à 08:10:23

tchounet a écrit:
Eh ZEDDDDDDDDDD il y en a des pièces pour toi ça viens d'arriver !!!!!!!!!!!!          

et vii mais sauf que ça c'était avant mon superbe croutage à  Issoire alors les pièces c'est plutot moi qui vais les piquer à  Zedddddddd  :D  :D  :lol:   :lol:

Ah non, le premier qui touche à  ma ligne Akra je le mord... :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: tchounet le 10 janvier 2007 à 13:36:58
after the crash  :oh:  :upset:
Titre: Re : Vos montures en photos
Posté par: ZedMed le 10 janvier 2007 à 15:03:34
Aie, rien que d'y voir ça me fait mal au coeur...
Trops prohéminents les carters sur la Z...
Titre: Re : Vos montures en photos
Posté par: tchounet le 10 janvier 2007 à 21:53:12
bon maintenant ke j'ai compris l'truc je vous mets deux trois tofs de +

ma Z à  ces débuts

ma selle perso

les pots GPR d'la balle !!!
Titre: Re : Vos montures en photos
Posté par: ReedSmith le 10 janvier 2007 à 22:05:14
je confirme : les carters sont trop prohéminents .... :-(
Titre: Re : Vos montures en photos
Posté par: ninja6 le 10 janvier 2007 à 22:31:46

ReedSmith a écrit:
je confirme : les carters sont trop prohéminents .... :-(

c'est trop prohéminents ça accroche les lapins  :D  :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 11 janvier 2007 à 00:58:21
... et les ronds points z'aussi :-(
Titre: Re : Vos montures en photos
Posté par: Tonyo le 11 janvier 2007 à 01:01:59

Silent Phong a écrit:
... et les ronds points z'aussi :-(

et après on mange des frites... ;-) :lol:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 11 janvier 2007 à 01:26:36
toi taggle !!!! :lol:
Titre: Re : Vos montures en photos
Posté par: TITIZ69 le 15 janvier 2007 à 13:18:29

Silent Phong a écrit:
... et les ronds points z'aussi :-(

Sans oublier les buissons et les arbres  :-(
Titre: Re : Vos montures en photos
Posté par: Christian le 16 janvier 2007 à 22:48:49
trés belle ta Z  ;-)
Titre: Re : Vos montures en photos
Posté par: Tazette le 24 janvier 2007 à 20:00:05
Bon allez, je me lance...

rien à  voir avec les grosses cylindrées, mais c'est ma Moto! J'ai mis Moto avec un grand M, parce que c'est la première...:D et qu'c'est la mienne ;-)

avec son p'tit pot ses p'tits rétros et sa p'tite bulle qui va bien!!  
bref voici quelques petites photos de mon jouet...


voili voilou!!!

Titre: Re : Vos montures en photos
Posté par: sphinx le 24 janvier 2007 à 20:14:48
trés joli cette petite er5 !!! :D

et je devance un peu les mauvaises langues... :
la ligne remus est trés zoliii... et elle doit faire un trés beau son... :lol:  :D
Titre: Re : Vos montures en photos
Posté par: Tazette le 24 janvier 2007 à 20:22:25

sphinx a écrit:
trés joli cette petite er5 !!! :D

et je devance un peu les mauvaises langues... :
la ligne remus est trés zoliii... et elle doit faire un trés beau son... :lol:  :D


elle fait effectivement un joli "petit"bruit...Prof se plaint de mieux entendre ma moto que la sienne quand on roule ensemble... :lol:  :lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 25 janvier 2007 à 10:30:24
Elle a l'air en parfait état, et elle brille :D !!!!!
Titre: Re : Vos montures en photos
Posté par: Hurl le 25 janvier 2007 à 10:43:27
Elle a l'air toute neuve ! ;-)
Continue à  bien l'entretenir et évite de la rayer, et toi aussi par la même occasion ;-)
Titre: Re : Vos montures en photos
Posté par: Tazette le 25 janvier 2007 à 10:50:13
vi on va essayer de rester sur nos deux roues toutes les deux!!! :lol:  :lol:  :lol:
j'roule tranquille, mais sait-on jamais! ;-)

Titre: Re : Vos montures en photos
Posté par: kokiu le 25 janvier 2007 à 18:37:02
tres jolie ta moto en plus elle brilleeeeeeeeeeeeeeee fait toi plaisir avec et @ bientà´t pour une ballade LM
Titre: Re : Vos montures en photos
Posté par: Rastaman le 25 janvier 2007 à 20:53:17
Très jolie ta moto Tazette elle a l'air flambant neuve !!!  ;-)
Titre: Re : Vos montures en photos
Posté par: ptiteguepe le 25 janvier 2007 à 22:43:51
MaZette, elle est très zoulie ta Moto...

Enfin... presk aussi zoulie que ma mienne... :lol: :lol:

Nan ! j'rigole ! elle est très bien !!

On va en faire des balades...  

Les filles en force sur LM !!!!!!  :D
Titre: Re : Vos montures en photos
Posté par: Tazette le 25 janvier 2007 à 22:44:12

Rastaman a écrit:
Très jolie ta moto Tazette elle a l'air flambant neuve !!!  ;-)

pas toute neuve, mais bien entretenue...
pourvu qu'ça dure!!! :-)
Titre: Re : Vos montures en photos
Posté par: tchounet le 27 janvier 2007 à 07:56:52
super belle Ta Moto .... normal c'est une Kawa
Pas de Kawa, pas de chocolat !!!! :lol:
Titre: Re : Vos montures en photos
Posté par: Tazette le 27 janvier 2007 à 08:29:07
:lol:  :lol:
Titre: Re : Vos montures en photos
Posté par: knives_69 le 27 janvier 2007 à 10:57:50

sphinx a écrit:
trés joli cette petite er5 !!! :D

et je devance un peu les mauvaises langues... :
la ligne remus est trés zoliii... et elle doit faire un trés beau son... :lol:  :D

Titre: Re : Vos montures en photos
Posté par: le 27 janvier 2007 à 20:24:29
Un pti test  :oops:

Merci aux modos ou aux forumeurs de me dire si ma signature est trop volumineuse  ;-)
Titre: Re : Vos montures en photos
Posté par: le 27 janvier 2007 à 20:26:07
oups ...
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 28 janvier 2007 à 12:34:38

Franck64 a écrit:
Un pti test  :oops:

Merci aux modos ou aux forumeurs de me dire si ma signature est trop volumineuse  ;-)

mouais bof, c'est vrai qu'elle n'est pas spécialement petite, mais bon ... on a vu bien pire  :D
Titre: Re : Vos montures en photos
Posté par: Tazette le 28 janvier 2007 à 13:34:41

Franck64 a écrit:
oups ...

j'ai cru que tu postais des photos  :lol:  :lol:
mais sinon, très jolie ta signature!!! ;-)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 28 janvier 2007 à 14:35:33
ou alors, peut être la réduire d'un bon 1/3 en hauteur, ça devrait suffir
Titre: Re : Vos montures en photos
Posté par: le 29 janvier 2007 à 08:56:23
Voilou chef !  :D
Titre: Re : Vos montures en photos
Posté par: BuskerEd le 29 janvier 2007 à 14:02:04
C'est moi, on a pas la meme notion du 1/3....vois pas de changement moi.....mou hahaha :D
Titre: Re : Vos montures en photos
Posté par: Frédéric le 29 janvier 2007 à 15:15:07
Moi je la reduirais bien de 5/6ème pour n'en garder qu'une seule :D


Titre: Re : Vos montures en photos
Posté par: le 29 janvier 2007 à 16:23:48
Si si busker, j'ai bien réduit d'un tiers ! tu peux me croire  ;-)

Et pour ce qui est de garder la ducati ... c'est celle que j'ai préférée sur route et celle qui m'a le plus déçu sur piste ...  :-P mais elle avait des circonstances agravantes  :lol:
Titre: Re : Vos montures en photos
Posté par: blab le 29 janvier 2007 à 16:31:10

Franck64 a écrit:
Si si busker, j'ai bien réduit d'un tiers ! tu peux me croire  ;-)

Et pour ce qui est de garder la ducati ... c'est celle que j'ai préférée sur route et celle qui m'a le plus déçu sur piste ...  :-P mais elle avait des circonstances agravantes  :lol:

il manquait des boulons ...  :D
Titre: Re : Vos montures en photos
Posté par: jean mi le 30 janvier 2007 à 21:25:39
ta sigantureest trop top mais sans les smilles ça aura plus de gueule,   ohohohohoh.
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 03 février 2007 à 17:04:25
voilà  ma nouvelle mobylette  :D

certe ça change du CBR mais pour avoir fait mes 200 premiers km avce là  .... ben ça me va tres bien  :D

faut juste que je vois ce que donne l'éclairage de nuit pour les nocturnes :D

enfin j'ai fais le retour Bourgoin les avenières avec 1 gexx750 , 1 600 cbr et un 1000 :D  on est arrivé en même temps  :D donc ça va :D

vala la bête..

( (

( (

préparer vos doudounes pour une tite hivernale avce la partie crêpe qui va bien avec :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Kyung le 03 février 2007 à 17:07:29
Frankounet l'a une Suz dans son garage :D  :D  ;-)
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 03 février 2007 à 17:19:04

Kyung a écrit:
Frankounet l'a une Suz dans son garage :D  :D  ;-)

ouiii mais mon coeur sera toujours fidel à  mon 900 mon pseudo restera toujours Fireblade  :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: Kyung le 03 février 2007 à 17:26:38

Fireblade98 a écrit:

Kyung a écrit:
Frankounet l'a une Suz dans son garage :D  :D  ;-)

ouiii mais mon coeur sera toujours fidel à  mon 900 mon pseudo restera toujours Fireblade  :D  :D  :D  :D

Personne n'est parfait :D  :lol:
Titre: Re : Vos montures en photos
Posté par: sphinx le 03 février 2007 à 20:55:42
belle aquisition... :D

a quand l'hivernal avec les crepes...? :-P
Titre: Re : Vos montures en photos
Posté par: Tazette le 03 février 2007 à 23:06:32

Fireblade98 a écrit:
voilà  ma nouvelle mobylette  :D

certe ça change du CBR mais pour avoir fait mes 200 premiers km avce là  .... ben ça me va tres bien  :D

faut juste que je vois ce que donne l'éclairage de nuit pour les nocturnes :D

enfin j'ai fais le retour Bourgoin les avenières avec 1 gexx750 , 1 600 cbr et un 1000 :D  on est arrivé en même temps  :D donc ça va :D

vala la bête..

( (

( (

préparer vos doudounes pour une tite hivernale avce la partie crêpe qui va bien avec :D  :D  :D  :D

bonne route avec la p'tite nouvelle!!!
Titre: Re : Vos montures en photos
Posté par: le 04 février 2007 à 06:23:14
Un ami avait la même... et c'est vrai que ça marchait plutà´t pas mal :-)
Titre: Re : Vos montures en photos
Posté par: furet le 04 février 2007 à 17:36:37
Voici enfin ma titine en photo,

( (

( (

Et voila
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 05 février 2007 à 02:56:24
Y'a pas à  dire : c'est beau une triumph! :yeah:

Quant au Gixxef à  Fireblade, rapport qualité / prix imbattable :D
Titre: Re : Vos montures en photos
Posté par: VFR01 le 05 février 2007 à 08:31:00
:-o  ba alors Fire t'as pas pu resister a l'appel de la moto  :D  :D  :D  :D  :D en totu cas bravo

ta dayto le furet  :love:  :love:  :love:  :love:  :love:  :love:  :love:  :love: un jours moi aussi j'en aurais une :roll:
Titre: Re : Vos montures en photos
Posté par: ZedMed le 05 février 2007 à 08:47:33

Fireblade98 a écrit:

voilà  ma nouvelle mobylette  :D

C'est bizarre mais ça ne m'étonnes même pas... :D  :D  ;-)
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 05 février 2007 à 14:24:25

Zedmed a écrit:

Fireblade98 a écrit:

voilà  ma nouvelle mobylette  :D

C'est bizarre mais ça ne m'étonnes même pas... :D  :D  ;-)

ben pour 1000 roros je pouvais pas louper ça  :D en plus en voyant l'état ! et 34 000km  :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 05 février 2007 à 14:36:33
C'est vrai, on dirait qu'elle est à  peine rodée, toute d'origine, avec les gros lampadaires.... euh .... clignotants :lol:
Titre: Re : Vos montures en photos
Posté par: blab le 05 février 2007 à 14:38:56

Fireblade98 a écrit:

ben pour 1000 roros je pouvais pas louper ça  :D en plus en voyant l'état ! et 34 000km  :D

 :-o  joli coup  :-)    et l'assurance qui doit etre toute légère aussi ?
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 05 février 2007 à 14:52:46

blab a écrit:

Fireblade98 a écrit:

ben pour 1000 roros je pouvais pas louper ça  :D en plus en voyant l'état ! et 34 000km  :D

 :-o  joli coup  :-)    et l'assurance qui doit etre toute légère aussi ?

ha ben là  on en parle même pas vi : 200 roros  :D l'année hein  :D  mais bon avec 50 ++ de bonus.

pis les pneux et autre aussi ...... :D  mais bon c'est pas un 900 cbr  non plus  :D

autre avantage : choupette la pilotera au moins celle là  puisqu'elle ne voulait plus prendre le 900.

enfin plus qu'a faire que ma boite tourne bien pour aller faire un tour pour acheter heuuu voir le 3 pattes anglais  :D

c'est vrai que là  c'est vraiment out d'origine  :D  mais bon elle est bien comme ça et le restera  :D

le look je m'en fou  :D ce que je voulais c'est roulerrrr et encore rouler  :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 05 février 2007 à 15:02:45

Fireblade98 a écrit:
le look je m'en fou  :D ce que je voulais c'est roulerrrr et encore rouler  :D

vi vi, alors......... roule ma pouuuuuuuuule !!! :lol:
Titre: Re : Vos montures en photos
Posté par: ritchie le 05 février 2007 à 22:23:13
Voilà  des photos de ma dtmx en attendant des photos de ma gs


/home/pierre/Desktop/photos/moto/profil droit.jpg
Titre: Re : Vos montures en photos
Posté par: ritchie le 05 février 2007 à 22:26:47
Excuser moi j'ai un problème avec les photos je les enverrai dés que ça sera résolu.
Titre: Re : Vos montures en photos
Posté par: Clochette le 05 février 2007 à 22:28:12

Fireblade98 a écrit:

ben pour 1000 roros je pouvais pas louper ça  :D en plus en voyant l'état ! et 34 000km  :D

Si tu en as d'autres des plans comme ça je suis preneur ;-)
Titre: Re : Vos montures en photos
Posté par: ritchie le 05 février 2007 à 23:16:15
Je réessaye de vous envoyer une photo du dtmx


Bon ben ça veut pas je verrai plus tard
Titre: Re : Vos montures en photos
Posté par: VFR01 le 06 février 2007 à 09:43:47
et voila nouvelle de MVA38, c'est un 750 gs-e

( (

il y a du boulot mais elle va etre  :-)
Titre: Re : Vos montures en photos
Posté par: greg le 06 février 2007 à 10:57:07

Fireblade98 a écrit:
voilà  ma nouvelle mobylette  :D

certe ça change du CBR mais pour avoir fait mes 200 premiers km avce là  .... ben ça me va tres bien  :D

faut juste que je vois ce que donne l'éclairage de nuit pour les nocturnes :D

enfin j'ai fais le retour Bourgoin les avenières avec 1 gexx750 , 1 600 cbr et un 1000 :D  on est arrivé en même temps  :D donc ça va :D

vala la bête..

( (

( (

préparer vos doudounes pour une tite hivernale avce la partie crêpe qui va bien avec :D  :D  :D  :D

ben en voila des bonnes nouvelles misa part que c'est suzuki  :D
non je plaisante  :lol:
Titre: Re : Vos montures en photos
Posté par: ritchie le 06 février 2007 à 18:52:03
voila je réessaye de mettre une photo
( (
si ça ne marche c'est que je suis un manche et est ce que quelqu'un peut m'expliquer comment mettre une photo qui est sur mon ordi?
Titre: Re : Vos montures en photos
Posté par: Tazette le 06 février 2007 à 19:00:54

ritchie a écrit:
voila je réessaye de mettre une photo
( (
si ça ne marche c'est que je suis un manche et est ce que quelqu'un peut m'expliquer comment mettre une photo qui est sur mon ordi?

Yes ça marche!!!
Titre: Re : Vos montures en photos
Posté par: le 06 février 2007 à 23:11:18
Hormis le Z750 que j'ai mis en vente dans les pages... voici la moto du RST... Celle qui fera le CFE cette année ...



Titre: Re : Vos montures en photos
Posté par: Silent Phong le 07 février 2007 à 10:09:39
Un 750 K3 de piste !!!!!! exactement ce qu'il me faudrait ... pour le loisir .... parce que le CFE :roll:
Titre: Re : Vos montures en photos
Posté par: ZedMed le 07 février 2007 à 10:33:04

Silent Phong a écrit:
Un 750 K3 de piste !!!!!! exactement ce qu'il me faudrait ... pour le loisir .... parce que le CFE :roll:

+1, mais il me manque encore quelques euros...!!!  :D
Titre: Re : Vos montures en photos
Posté par: ritchie le 07 février 2007 à 11:13:20
Voilà  une autre photo du dtmx et deux photos du GS

( (
( (
( (
Titre: Re : Vos montures en photos
Posté par: le 07 février 2007 à 11:40:35


Titre: Re : Vos montures en photos
Posté par: jmf69150 le 07 février 2007 à 17:47:49
bjr a toi, juste une petite question ? ta ducat, tu ne l'aurais pas acheter a Dardilly  chez Ducat ?
Titre: Re : Vos montures en photos
Posté par: Kokito le 07 février 2007 à 18:13:21

jmf69150 a écrit:
bjr a toi, juste une petite question ? ta ducat, tu ne l'aurais pas acheter a Dardilly  chez Ducat ?

Euh de quelle Ducat tu parles ?  :D
Titre: Re : Vos montures en photos
Posté par: Jean-Luc le 07 février 2007 à 19:43:30
Celle qui fait prout©95 ou pas ?  ;-)
Titre: Re : Vos montures en photos
Posté par: Seb le 09 février 2007 à 12:31:13
ba voici mes miennes...

Y 'a encore du boulo pour la restauration du 400 :roll:

EDIT : merci d'éviter les posters... ;)
Titre: Re : Vos montures en photos
Posté par: NeNe le 17 février 2007 à 19:35:49


Titre: Re : Vos montures en photos
Posté par: Silent Phong le 18 février 2007 à 00:25:38
Pfiouuu!! avec tous ces gens qui changent de brêle, ça donne envie de faire péter un beau modèle .... :-(
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 18 février 2007 à 02:12:54

Silent Phong a écrit:
Pfiouuu!! avec tous ces gens qui changent de brêle, ça donne envie de faire péter un beau modèle .... :-(

a quiii le dis tuuuu  :D  :D  :D

mais comme on dir parience est mere de sureté  :D  :D

comment ça je suis pas patient?? :D  :D

en tout cas NENE ça fait plaiz pour toi  :pouces:  :pouces:

(ça va faire bizard de lus te voir en GEX toué :D )
Titre: Re : Vos montures en photos
Posté par: eldarin le 18 février 2007 à 09:16:04

Fireblade98 a écrit:

(ça va faire bizzard de plus te voir en GEX toué :D )

Bouuuuuuuuuuuuuuuuuuuuuuuu!!!  :mad:  :mad:

 :D   Maintenant il sera bon qu'a fermer les groupes  :D  :D
Titre: Re : Vos montures en photos
Posté par: le 18 février 2007 à 12:23:07

Fireblade98 a écrit:
mais comme on dir parience est mere de sureté  :D  :D

comment ça je suis pas patient?? :D  :D
C'est pas plutà´t "prudence"?! :-P
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 18 février 2007 à 17:42:14

-Flo- a écrit:

Fireblade98 a écrit:
mais comme on dir parience est mere de sureté  :D  :D

comment ça je suis pas patient?? :D  :D
C'est pas plutà´t "prudence"?! :-P

 oui en reel c'est bien "prudence est.... maman de sureté  :D  :D " ;-)
Titre: Re : Vos montures en photos
Posté par: bruno le 24 février 2007 à 11:41:19

j'espere que ca a marché c'et ma mobylette a moi.

c'est une vraie bombinette....
Titre: Re : Vos montures en photos
Posté par: Ben le 24 février 2007 à 12:20:12
C'est la version wakizashi... MIAM.
Titre: Re : Vos montures en photos
Posté par: bruno le 24 février 2007 à 12:25:55
oui c'est la wakisachi.c'est sympa comme kit. :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: BALLA le 24 février 2007 à 12:28:47

baboulinet a écrit:

j'ai peur que ton deuxième lien soit un peu écourté...  :roll:
Titre: Re : Vos montures en photos
Posté par: Frédéric le 24 février 2007 à 12:37:15
Et pour le premier lien, la qualité est pas top  :-(  dommage!!


Ben a écrit:
C'est la version wakizashi... MIAM.

Et oui on dirait bien la série spéciale "yamasakisushi" :D  :lol:  :lol:  :lol:

Titre: Re : Vos montures en photos
Posté par: Ben le 24 février 2007 à 12:39:32
On a pas tous les moyens de se payer la brèle plus le kit qui va bien!
Moi je la trouve sympa. Couleur inscriptions tout quoi.
y'a quelque chose qui te déplait dans ce "kit"?
Titre: Re : Vos montures en photos
Posté par: bruno le 24 février 2007 à 23:01:03
pour le 2eme  lien j'ai du faire une mauvaise manip.

et le kit me convient parfaitement, ca change un peu de tt se que l'on peut voirc different mais plus cher,il me semble que le kit coute environ 800 euros....c'est pas donné mais ca la rend plus belle...

 :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: jeje69 le 26 février 2007 à 15:14:51

baboulinet a écrit:
pour le 2eme  lien j'ai du faire une mauvaise manip.

et le kit me convient parfaitement, ca change un peu de tt se que l'on peut voirc different mais plus cher,il me semble que le kit coute environ 800 euros....c'est pas donné mais ca la rend plus belle...

 :D  :D  :D

Je prefere mon kit a moi qui en vaut 1800  :D  elle est plus joli

Nan je déconne je pense qu'elle est sympa comme ca a voir en vrai car j'en ai encore jamais vu  ;-)
Titre: Re : Vos montures en photos
Posté par: greg le 26 février 2007 à 18:17:21
j'aime la version mais ils en vendaient plus quand j'ai appelé
Titre: Re : Vos montures en photos
Posté par: grinbergen le 07 mars 2007 à 17:25:37
donc revoici mon joujou apres qqs tofs dans ma presentation.

pour la route

( ( (


pour la piste

( ( (
( ( (

la meilleur des motos ,12 mois que je l'ai et aucun reproche.
que du bonheur pour rien au monde je changerais meme pour le k7.
Titre: Re : Vos montures en photos
Posté par: Winnie le 07 mars 2007 à 17:54:48
Apres la presentation de l'ourson, voici celle de sa monture. Non ce n'est pas bourriquet mais un joli petit 600 bandit de 1995.

( (

( (

( (

C'est ma premiere monture et plus sa va plus je l'aime, je trouve que c'est une super bonne moto pour débuter.
Titre: Re : Vos montures en photos
Posté par: Ben le 07 mars 2007 à 20:13:42
Bin vi elle a l'air sympa comme tout! :-)
Pis y'a deux vraies place... :D
Titre: Re : Vos montures en photos
Posté par: Winnie le 08 mars 2007 à 09:16:16
A toi qui vient d'avoir ton permis, je te conseil vivement le bandit, c'est une super becane pour debuter qui n'est pas trop cher a assurer ni a entretenir.
Effectivement une bonne selle que mon SDS apprecie, il me manque juste des poignnees passager que j'ai acheter, faut juste que je les monte
Titre: Re : Vos montures en photos
Posté par: mva38 le 22 mars 2007 à 10:33:55
( (

voila ma nouvelle monture :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: VFR01 le 22 mars 2007 à 10:35:46

mva38 a écrit:
( (

voila ma nouvelle monture :D  :D  :D  :D

et une rital de plus une  :roll: elle est belle ta monture MVA :-) mais au faite st'arrose ça quand :D  :D  :D  :D  :pint:  :pint:  :pint:  :pint:  :pint:
Titre: Re : Vos montures en photos
Posté par: no69 le 22 mars 2007 à 20:40:48

VFR01 a écrit:

mva38 a écrit:
( (

voila ma nouvelle monture :D  :D  :D  :D

et une rital de plus une  :roll: elle est belle ta monture MVA :-) mais au faite st'arrose ça quand :D  :D  :D  :D  :pint:  :pint:  :pint:  :pint:  :pint:

Titre: Re : Vos montures en photos
Posté par: mva38 le 22 mars 2007 à 20:51:11

no69 a écrit:

VFR01 a écrit:

mva38 a écrit:
( (

voila ma nouvelle monture :D  :D  :D  :D

et une rital de plus une  :roll: elle est belle ta monture MVA :-) mais au faite st'arrose ça quand :D  :D  :D  :D  :pint:  :pint:  :pint:  :pint:  :pint:


quand vous voulez vous avez qu'a viendrir a la maison :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: VFR01 le 22 mars 2007 à 20:53:05

mva38 a écrit:

no69 a écrit:

VFR01 a écrit:

mva38 a écrit:
( (

voila ma nouvelle monture :D  :D  :D  :D

et une rital de plus une  :roll: elle est belle ta monture MVA :-) mais au faite st'arrose ça quand :D  :D  :D  :D  :pint:  :pint:  :pint:  :pint:  :pint:


quand vous voulez vous avez qu'a viendrir a la maison :D  :D  :D  :D

chiche  :D  :D  :D  :D  :D  :D  :D  :D
Titre: Re : Vos montures en photos
Posté par: mva38 le 22 mars 2007 à 20:54:56
méme pas cape :-P  :-P  :-P  :-P
viende a la maison puis on feras une p'tite balade aprés ;-)  ;-)
Titre: Re : Vos montures en photos
Posté par: VFR01 le 22 mars 2007 à 21:01:48

mva38 a écrit:
méme pas cape :-P  :-P  :-P  :-P
viende a la maison puis on feras une p'tite balade aprés ;-)  ;-)

ah ba si tu me prends par les sentiments  :roll:
Titre: Re : Vos montures en photos
Posté par: Hurl le 23 mars 2007 à 16:15:53

mva38 a écrit:
( (

voila ma nouvelle monture :D  :D  :D  :D

Espèce de gros enfoiros !!!  :-o  :D
Félicitations et bienvenue sur une vraie moto  :D

C'est un modèle de 99 ne me trompe-je ?
J'en connais un qui devrait avoir pas mal de pièces à  te refourguer si ca t'intéresse.

Pour l'arrosage, files ton adresse !  ;-)

Tu t'es inscrit sur le forum aprilia ? Tu verras, c'est une mine d'informations pour ces magnifiques motos.
Et si t'a besoin de conseils ou d'infos, hésites pas, il y a pas mal de choses communes avec le falco.
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 05 août 2007 à 12:27:26
Bon, et bien après cette excellente journée piste du 4 aout au circuit de Bresse,  :D
journée qui a dévoilé mon "secret"  ;)

Je vous présente donc mon nouveau jouet exclusivement réservé à la piste:

Triumph Daytona 955i de 2003!!!!!!!!

( (

( (

Un grand merci à Ninja6 :top: et Fireblade98 :top: qui ont permis la réalisation de mon projet grâce à leurs compétences en bricolage et surtout leur très grande disponibilité  :)  :top:

" Silent' is back on tracks !!!!!!!!!!! "  >:D >:D >:D

( (
(photo Fireblade98 - Bresse 4 aout 07)

et plus que jamais ....

Triumph Po-Po-Powaaaaaaaaaaaaaaaaaaaaaa !!!!!!!!!!!!!!

Titre: Re : Vos montures en photos
Posté par: Hurl le 06 août 2007 à 11:50:38
Le grand secret pas si secret que ca :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 19 février 2008 à 08:52:28
Superbe ce Neyrin !!!  :top:
Moi qui ne suis pas un grand fan des liserets sur les jantes, je dois avouer que les blancs sur l'ex à NayNay rendaient un bien bel effet ...  ;)
Titre: Re : Vos montures en photos
Posté par: NeNe le 19 février 2008 à 20:30:00
ca faisait racingueeeeeeeeee  :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: Yann38 le 19 février 2008 à 21:39:24
- Voici ma moto pour mes jours ou j'ai envie de rigoler :


- Ma moto de route :


- Ma moto d'enduro à gauche (la jaune) à droite c'est celle de mon père :

Titre: Re : Vos montures en photos
Posté par: jolop le 19 février 2008 à 22:06:01
la mienne prete a pister

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 19 février 2008 à 22:08:06
Belle brêle poto Jo !!  :top: avec des boudins neufs qui ne demandent qu'à boulocher !!!  ;)

'va falloir revoir ta bannière !  :D
Titre: Re : Vos montures en photos
Posté par: crampon le 19 février 2008 à 23:45:00
Me suis présenté faut bien que je présente mes motos..

voilà ma 250 wrf modèle 2004

( (

et ma 600 fazer modèle 2001

( (

Titre: Re : Vos montures en photos
Posté par: Osmose69000 le 22 février 2008 à 14:29:55
( (

( (

( (

Voili voilou !
Titre: Re : Vos montures en photos
Posté par: blab le 22 février 2008 à 14:36:28
Et pour aller encore plus vite, te reste plus qu'a peindre ta tete de fourche et surtout le bras oscillant en FULL BLACK !!!
Titre: Re : Vos montures en photos
Posté par: Osmose69000 le 22 février 2008 à 14:39:18
Et pour aller encore plus vite, te reste plus qu'a peindre ta tete de fourche et surtout le bras oscillant en FULL BLACK !!!

Titre: Re : Vos montures en photos
Posté par: guillaume le 22 février 2008 à 14:43:00
la mienne prete a pister


Superbe la coque arrière. Tu vas te gaver avec çà mon keuchon !  :top:
Titre: Re : Vos montures en photos
Posté par: NeNe le 22 février 2008 à 16:14:04
à l'achat total origine :


maintenant avec support de plaque rizoma de Yam R1 modifié par mes soins, et des liserets blancs du plus bel effet  :geek:


mais ce n'est pas fini, rendez vous dans environ 2 semaines pour l'évolution presque définitive
Titre: Re : Vos montures en photos
Posté par: Hurl le 22 février 2008 à 16:17:05
Et on peut pas avoir une zolie photo du support de plaque ?
Où t'a peur qu'on voit la plaque marquée "1234 FUK 69" ?  ;D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 22 février 2008 à 16:19:21
Hurl, c'est pas pire que la tienne 666 PD 69 !!!  :2funny:
Titre: Re : Vos montures en photos
Posté par: ninja6 le 22 février 2008 à 16:24:20
elle est belle mon néné   , je sens bien venir le pot qui vas bien   ::)
Titre: Re : Vos montures en photos
Posté par: Pous' le 22 février 2008 à 16:26:59
voilà mon bébé... à qd la deuxième!!!!!! hi hi hi...
Titre: Re : Vos montures en photos
Posté par: NeNe le 22 février 2008 à 16:29:57
Et on peut pas avoir une zolie photo du support de plaque ?
Où t'a peur qu'on voit la plaque marquée "1234 FUK 69" ?  ;D

 :2funny: :2funny: arrête sur la plaque du R1 c'était marqué ASK 69 (demandez un 69 en anglais) :-[ :2funny: :2funny: (c'était Kayloo qui me l'avais fait remarquer  :2funny:)

voila le support, mais il va être remodifiée  ;) :



Titre: Re : Vos montures en photos
Posté par: Hurl le 22 février 2008 à 16:31:08
Ok néné, faudra que je regarde ca de prêt.

Hurl, c'est pas pire que la tienne 666 PD 69 !!!  :2funny:
'foiré  :2funny:
Titre: Re : Vos montures en photos
Posté par: Winnie le 22 février 2008 à 16:39:54
Mignon ce petit aileron sur le cul de ton triple néné, c'est pour l'aérodynamisme ?  :P
Titre: Re : Vos montures en photos
Posté par: Armène le 22 février 2008 à 17:01:49
Y manque pas un petit rétro aussi  :coolsmiley:

V, Armène
Titre: Re : Vos montures en photos
Posté par: NeNe le 22 février 2008 à 17:26:33
Mignon ce petit aileron sur le cul de ton triple néné, c'est pour l'aérodynamisme ?  :P

 :2funny: :2funny: bien vu l'aveugle  :geek:

depuis aujourd'hui 15h30 il n'y ai plus  :P
Titre: Re : Vos montures en photos
Posté par: guillaume le 22 février 2008 à 18:54:13
Y'aurait pas un Zard qui prendrait position?  :P
Titre: Re : Vos montures en photos
Posté par: NeNe le 22 février 2008 à 19:07:52
Y'aurait pas un Zard qui prendrait position?  :P

trop cher mon fils  :-[... mais... tu n'est pas loin  ;)
Titre: Re : Vos montures en photos
Posté par: okidoki69 le 22 février 2008 à 19:22:06
Voici ma ZK7:






-Echappement léovince GP
-saute vent Ermax
-jantes polies + peinture
-feu arr. avec cligno intégré
-prochaine modif. selle Yves Moillo

Titre: Re : Vos montures en photos
Posté par: mva38 le 22 février 2008 à 20:30:27
le nouvelle  :love: :love: :love: :love: :love: :love: :love:
( (

( (

sa copine italienne,qui vas faire un p'tit tour sur piste pour fété les 70 000kms quelle à au compteur :o  >:D >:Dbella machina 8)
( (

( (

la mamie qui vas étre restauret un jour :geek:(faus vraiment que je m'y mette cette année elle à 30ans)
( (

Titre: Re : Vos montures en photos
Posté par: Franck64 le 26 février 2008 à 11:05:56
Qq photos de notre SS (à Diana et moi :love: ) fraichement repeint ! manque encore les motocollants  :P





Franchement, je comprend super bien les ducatistes qui vantent leurs motos soit disant des "motos d'hommes, avec un caractère exclusif", même si je ne suis pas un puriste (j'aime toutes les motos  :P )

Le caractère moteur est hallucinant  :o ! un couple de tracteur, ça vibre, ça cogne, ça vit ! c'est franchement un pur plaisir de rouler avec cette moto  :top: , et ce, en respectant les limitations de vitesse :D ! pas besoin de rouler vite, le couple à bas régime est bluffant !  ::)

La partie cycle est saine ! un peu physique à emmener, il faut enrouler et elle n'aime pas trop les routes en mauvais état à allure inavouable  :-X , mais ça reste drolement efficace ! tout est réglable évidement et c'est du trés bon équipement, même si c'est pas une superbike  ;)

Le freinage n'a pas l'attaque d'une Honda ! c'est doux et progressif, mais ça reste un freinage puissant si on tire sur le levier, pis avec le frein moteur du bi, on freine moins ;D

Niveau confort, c'est super bon ! surtout avec la selle perso  :) ! Diana adore le rôle de passagère, et je lui laisse donner ses impressions, mais elle aime aussi le rôle du pilote  8). 

Bref ! une moto qu'on a acheté à deux pour nous deux :love: , pour un usage route, des ballades sans risque de perdre le permis ou la vie, et surtout pour rouler en se faisant plaisir au maximum  ::) ::) ::)

PS : petit clin d'oeil à Eric ! merci pour tout  :top: , on la bichonne tu vois  ;)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 27 février 2008 à 19:54:48
Belle robe!!  :P
bon à part ça, c'est vrai que c'est vivant comme moto!   :)
Titre: Re : Vos montures en photos
Posté par: baz le 27 février 2008 à 20:04:57
Elle est magnifique  :love: J'ai failli en acheter une en novembre  :love:
Titre: Re : Vos montures en photos
Posté par: cool_eyer le 05 mars 2008 à 10:22:16
Bordel !!!

Comme elle est beeeeeeeeeeelle !! Là, du coup, vu comme la bichonnez, ça me fait moins mal de la voir partie...

Bravo, magnifique !
Titre: Re : Vos montures en photos
Posté par: zekoala le 09 mars 2008 à 17:21:26
Voilà la mienne... Le coté obscur commence à la ronger, par le bas... bientôt elle aura complètement viré de bord !


Titre: Re : Vos montures en photos
Posté par: Ptitducky le 09 mars 2008 à 17:34:03
C'est bô  :love: (sauf ces vilains clignos... ::))

Elle a combien de bornes ?
Titre: Re : Vos montures en photos
Posté par: zekoala le 09 mars 2008 à 18:01:14
C'est bô  :love: (sauf ces vilains clignos... ::))

Elle a combien de bornes ?

vilains? lesquels, les gouttes d'eau? il vont gicler sur la paire de carénage noirs, remplacés comme à l'arrière par ça :

Sinon, elle à 61000 km ;) à 100000 je fais péter le champagne et je m'inscrit là :,000+_club.htm (,000+_club.htm) (y'en a déjà une de 99  :top: )
Titre: Re : Vos montures en photos
Posté par: ezek le 09 mars 2008 à 22:07:00
Voici ma 'tite brèle :


Bonne petite moto pour les newbees ... ça tombe bien j'en suis un ! :geek:
Et avec son petit pôt carbone LEO je ne vous raconte pas la douce mélodie.  :top:
Titre: Re : Vos montures en photos
Posté par: VFR01 le 10 mars 2008 à 14:35:55
j'avais zappé ce topic  :-[
mon Dayto  :love: :love: le jours ou je l'ai recupéré
( (
en balade
( (
Titre: Re : Vos montures en photos
Posté par: zekoala le 10 mars 2008 à 20:16:25
c'est une couleur d'origine ton dayto?
Titre: Re : Vos montures en photos
Posté par: VFR01 le 11 mars 2008 à 08:38:12
c'est une couleur d'origine ton dayto?
oui oui 100 % c'est vrai qu'on en voi pas souvent des rouge  :love:

allez encore une pour la route

( (
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 11 mars 2008 à 08:42:59
vraiment sympa cette moto  :top: mais alors en noir comme avait le darinou.... :love: :love: :love:
Titre: Re : Vos montures en photos
Posté par: zekoala le 14 mars 2008 à 23:14:01
oui oui 100 % c'est vrai qu'on en voi pas souvent des rouge  :love:

allez encore une pour la route

( (

rhôôô ! la belle route à vache... ah mais oui, pardon, j'avais pas vu ta signature !!!
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 16 mars 2008 à 19:01:53
encore qq photo... elles est tellement jolies... :lol!:


une avec ma bete à poils préférée ( et je parle pas de jolop)

Titre: Re : Vos montures en photos
Posté par: Ravage le 16 mars 2008 à 19:07:11
voila la mienne

Titre: Re : Vos montures en photos
Posté par: Crocodilebendee le 19 mars 2008 à 12:26:33
Allez, y'a pas de raison, meme les mamies ont le droit d'avoir leurs photos dans LM  :)
Voila Mamie VFR ( Vraiment Faite pour Rouler ? ), 70.000kms et toutes ses dents ... de pignons de sortie de boite  ;D.
Aussi, elle est un peu 'liberee' la mamie, et puis dans sa bonne vieille robe rouge elle ne fait pas si moche et vieille ... si ?
Bon d'accord ....    >:(



Prochains episodes:

- Mamie dans le Bush ( jumelee avec Mamie Manouche => sympa les valises :idiot: )


- Mamie cra-cra:
Titre: Re : Vos montures en photos
Posté par: ChoCoPunX le 19 mars 2008 à 13:03:23
voila la mienne


J'avais encore jamais vu un "A" sur une moto!  :P
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 19 mars 2008 à 21:25:28
Sympa le Vifer  :top: ... par contre, ton D220 (photo 2), il serait pas tout carré ??? ??  ;D  ;)
Titre: Re : Vos montures en photos
Posté par: MIKE le 19 mars 2008 à 21:27:39
Sympa le Vifer  :top: ... par contre, ton D220 (photo 2), il serait pas tout carré ??? ??  ;D  ;)

Il y avait pas de virages là bas ...  :geek:

Que de grands espaces ...  :2funny:
Titre: Re : Vos montures en photos
Posté par: Crocodilebendee le 20 mars 2008 à 01:31:46
Sympa le Vifer  :top: ... par contre, ton D220 (photo 2), il serait pas tout carré ??? ??  ;D  ;)

Carré ? Hein ?? Ca veut dire quoi ce mot ??? Connait pas ....  :2funny:
Ah mais non mais je sais en fait sur les deux premieres photos je venais juste de racheter la moto a un collegue qui roulait comme une ... ( en anglais ds le texte ) ... c'est pour ca !  ;D
Comment ca "mauvaise foi" ? Je suis pas credible ??  :-X :2funny:
Titre: Re : Vos montures en photos
Posté par: Stephane69 le 24 mars 2008 à 10:34:23

Alors c'est ici le topic de présentation de nos belles.

Alors voilà GroBeuMeu alias un Béhème R1100S de 2000 acheté il y a 2 mois avec 32000km. Pas encore bien en main. Légères modifications : silencieux Nasca, bulle noire, cligno blancs, lèche-roue et tapis de réservoir pour emmener le toutou dans son sac Bagster.

Visant à faire des économies sur mon budget moto, je l'ai acheté pour remplacer mon ex GroBeuMeu, un Béhème R850R de Novembre 2005, totalisant 38500km, la seule moto neuve que je me sois achetée. Mais voilà, à force d'essayer en hiver quelques R1100S avant la vente du Roadster, ben j'ai craqué  :idiot:

Et puis juste pour le plaisir, j'en rêvais gamin et je l'ai gardé 1 an, l'année dernière, une petite prépa de supermotard sur la base d'un XT 600

Bonne route et prudence


Titre: Re : Vos montures en photos
Posté par: MaxB le 24 mars 2008 à 11:08:32
Allez, je résiste pas à mettre aussi une ch'tite photo de la remplaçante de ma Faclo.......

Une Aprilia bien sûr (ah, ces bicylindres ROTAX                  ::)             )


RSV-R SBK Haga Replica n°165                 :)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 24 mars 2008 à 12:02:18
Un bien belle machine  :2funny: ... par contre, y'a pas un peu trop d'autocollants ?  :D
Titre: Re : Vos montures en photos
Posté par: MaxB le 24 mars 2008 à 12:05:29
Un bien belle machine  :2funny: ... par contre, y'a pas un peu trop d'autocollants ?  :D

Ben ils y étaient tous et si je les enlève ça va faire des traces sur le carénage        ;D
Titre: Re : Vos montures en photos
Posté par: airpébé le 24 mars 2008 à 13:38:53
Un bien belle machine  :2funny: ... par contre, y'a pas un peu trop d'autocollants ?  :D

Ben ils y étaient tous et si je les enlève ça va faire des traces sur le carénage        ;D

laisses les ces motocollants ,ça ne me gênera pas de rouler dessus  :idiot: :2funny:
Titre: Re : Vos montures en photos
Posté par: MM69 le 24 mars 2008 à 13:42:16
cool la RSV R mais les Replica, y a toujours un coté "Jacky Tuning Touch"  :2funny:
Titre: Re : Vos montures en photos
Posté par: nightbird le 28 mars 2008 à 10:32:57
Et voici ma bandit 650 k7

( (

( (

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: director le 29 mars 2008 à 15:11:57
cool la RSV R mais les Replica, y a toujours un coté "Jacky Tuning Touch"  :2funny:

+1 pour la jacky moto ;D
Titre: Re : Vos montures en photos
Posté par: mva38 le 29 mars 2008 à 16:09:49
y'as peut étre beau de totocolant mais y'as un vraie moteur pas comme sur vos jap' >:D >:D >:D
Titre: Re : Vos montures en photos
Posté par: NeNe le 30 mars 2008 à 23:17:54

Titre: Re : Vos montures en photos
Posté par: fazerrr le 30 mars 2008 à 23:28:03
exccccellent sans les pots !  :top: ... y a un pti coté mad max ! suuublime
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 30 mars 2008 à 23:39:23
Une brêle de Bad Boy  ::) de Brute Epaisse comme j'aime à le dire  :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: NeNe le 30 mars 2008 à 23:41:12
Une brêle de Bad Boy  ::) de Brute Epaisse comme j'aime à le dire  :2funny: :2funny: :2funny:

comme moa quoi  :geek: :2funny:
Titre: Re : Vos montures en photos
Posté par: fazerrr le 31 mars 2008 à 00:12:16
brute epaisse ...Néné : trouvé l'erreur !
Posté le: 30 Mars 2008, 22:41:51
ah ben non, j'ai rien dit ............
Titre: Re : Vos montures en photos
Posté par: NeNe le 31 mars 2008 à 00:22:46
 :o :o :o

qu'est ce qui te prends de montrer mon anatomie comme ça en public ?  :2funny: :2funny:

faudrait que je pense à aller voir un coiffeur quand même...

 :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 31 mars 2008 à 09:10:52
Oooh la belle coupe de cheveux !!!  :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 31 mars 2008 à 09:16:31
La petite boucle d'oreille sur l'oreille droite !!!

Je te reconnais bien là mon NéNé d'amour !!!(

"Hummmm tu aimes les films de Gladiateurs!!!"
Titre: Re : Vos montures en photos
Posté par: Pous' le 03 avril 2008 à 15:54:05
Bon ben ca y est j'ai enfin la deuxieme!!! pour la piste uniquement!!!!!!!

Reste plus qu'a démonter tout ce qui sert à rien... trouver un poly... une remorque..; et tout et tout.... pfff tout ca qd meme!!! mdr!!
Titre: Re : Vos montures en photos
Posté par: juju le 03 avril 2008 à 21:21:24
ma katoche prête pour la piste



encore 10 jours a attendre....
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 03 avril 2008 à 21:22:56
Alors ça :love: :love: :love: ça doit être une pure machine à faire le con et à se faire plaiz'  :top: :top: :top:
Titre: Re : Vos montures en photos
Posté par: blab le 04 avril 2008 à 09:47:44
Ahhh qu'elle est belle Néné !  :love: Et quel arrière  :top:

Aucun sous entendu hein ? Je parle de la bécane et non de Néné le personnage hein ?  >:D
Titre: Re : Vos montures en photos
Posté par: Ben le 04 avril 2008 à 22:04:07
Miam ce supermot!  :top:
Titre: Re : Vos montures en photos
Posté par: MiSs-CrAzY le 05 avril 2008 à 19:04:42
Voici Mon petit bolide... Oui je sais, c'est la plus belle mddrrrrrr  ;D

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: Kinderbeno le 05 avril 2008 à 19:35:05
brute epaisse ...Néné : trouvé l'erreur !
Posté le: 30 Mars 2008, 22:41:51
ah ben non, j'ai rien dit ............

 ;D ;D

Je la met de coté celle la  >:D
Titre: Re : Vos montures en photos
Posté par: NeNe le 05 avril 2008 à 19:45:58
foirés  :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: zekoala le 06 avril 2008 à 23:37:35
cool la RSV R mais les Replica, y a toujours un coté "Jacky Tuning Touch"  :2funny:
ouaip... mais c'est bandant quand même !
Citation de: mva38
y'as peut étre beau de totocolant mais y'as un vraie moteur pas comme sur vos jap' Diabolique Diabolique Diabolique
jaloux  :dead:
Titre: Re : Vos montures en photos
Posté par: ZedMed le 14 avril 2008 à 20:27:46
Et voici ma nouvelle maitresse pour la piste, mais qui est aussi apte pour la route:


Elle est full origine, 1ere main, 21500kms, et petite glissade à gauche ce qui m'a valu de la toucher un peu moins cher que le prix du marché...

Elle est dans sa tenue d'origine, bientôt des polys prendront place et je vous montrerai l'évolution...  >:D >:D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 14 avril 2008 à 20:35:51
Tu l'as enfin !!!!!!!!!!! yeahh !!!  8) 8) 8)
Titre: Re : Vos montures en photos
Posté par: adrien le 14 avril 2008 à 20:39:25
mon 500cr pret pour la nouvelle saison avec un petit rafraichissement. J'ai passer le cadre en noir et mis une jante exel vu que j'avais exploser l'autre



Titre: Re : Vos montures en photos
Posté par: guillaume le 14 avril 2008 à 20:41:03
Et voici ma nouvelle maitresse pour la piste, mais qui est aussi apte pour la route:


Elle est full origine, 1ere main, 21500kms, et petite glissade à gauche ce qui m'a valu de la toucher un peu moins cher que le prix du marché...

Elle est dans sa tenue d'origine, bientôt des polys prendront place et je vous montrerai l'évolution...  >:D >:D

Bah mon keuchon  :top:
Titre: Re : Vos montures en photos
Posté par: NeNe le 14 avril 2008 à 21:38:22
 :top: :top: :top: au top mon Zedounet  :)
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 14 avril 2008 à 21:45:13
@ Adrien :

C'est quoi la boite sur le bras oscillant. on peut voir qu'il y a des durites.... ???
Titre: Re : Vos montures en photos
Posté par: ptitecox le 14 avril 2008 à 21:50:54
@ Adrien :

C'est quoi la boite sur le bras oscillant. on peut voir qu'il y a des durites.... ???

ca serai pas un récupérateur d'huile ou truc dans le genre ?
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 14 avril 2008 à 21:52:13
ça y ressemble bien en tout cas  :)
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 14 avril 2008 à 22:13:57
ca serai pas un récupérateur d'huile ou truc dans le genre ?

Pour les durites de trop plein ?  :D
Titre: Re : Vos montures en photos
Posté par: adrien le 14 avril 2008 à 22:21:55
recuperateur de fluide obligatoire pour roulé en supermot
Titre: Re : Vos montures en photos
Posté par: labestiole le 17 avril 2008 à 18:50:04
( (

C'est ma mienne prise au col de Verdun, un jour de temps bien humide. Douuuuuuuuuuuucement dans les virages........ça glisse ça glisse ça glisse  :(
Titre: Re : Vos montures en photos
Posté par: Clochette le 20 avril 2008 à 19:23:24
J'avais oublié de la mettre  ::)

( (
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 20 avril 2008 à 23:05:06
J'avais oublié de la mettre  ::)

Jolie pelouse... :D :D :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: lezard le 21 avril 2008 à 08:33:55
Il faisait beau ce jour la et c'est vrai que le gazon est magnifique  >:D
Titre: Re : Vos montures en photos
Posté par: Clochette le 21 avril 2008 à 08:49:11
Il faisait beau ce jour la et c'est vrai que le gazon est magnifique  >:D

et oui il faisait beau hier,  :P bande de jaloux, et l'herbe n'était pas tondue ::)
Titre: Re : Vos montures en photos
Posté par: idltalk le 22 avril 2008 à 14:46:20
chouette bécane  :top:

Je croyais qu'il y avait un simple disque à l'avant moé ?
Titre: Re : Vos montures en photos
Posté par: sphinx le 24 avril 2008 à 13:07:55
après mon entrée dans ce topic avec cette ravissante et éblouissante diversion full patate de la mort qui tue pas...  ;D

( (   ( (

voici ma nouvelle titine  :love: :love: :love:

( (
Titre: Re : Vos montures en photos
Posté par: ZedMed le 24 avril 2008 à 13:12:54
Yeah !!!!!!!!!!!!!!!!!
KAWA powaaaaaaaaaaaaaa!!!!!  :top:
Titre: Re : Vos montures en photos
Posté par: Pous' le 24 avril 2008 à 13:15:28
oooyeahhhh!!!! feloch' Sphinxou!!!!!!!!!!!!! :top: :top:
Titre: Re : Vos montures en photos
Posté par: NeNe le 24 avril 2008 à 13:43:23
 :top: :top: :top: content que tu soit de retour, et super bon choix, elle a l'air super propre et totalement d'origine !
Titre: Re : Vos montures en photos
Posté par: triplestef le 24 avril 2008 à 13:56:16
et ben...personne l attendu celle ci sphinxou!!! pas de topic rien...nous a tous bien eu avec sa katoche
Titre: Re : Vos montures en photos
Posté par: Winnie le 24 avril 2008 à 14:03:25
Ba mon cochon !! elle sentirait presque le neuf tellement elle a l'air propre et d'origine :)
Titre: Re : Vos montures en photos
Posté par: alex le 24 avril 2008 à 16:41:40
Ho ami 86 tu vas rouler vraiment comme porcasse >:D Bravo :top:
Titre: Re : Vos montures en photos
Posté par: pop69 le 24 avril 2008 à 16:49:27
féloche mon sphinxounet :top:
mais tu ne pourra pas couper tes trajs a travers champs :geek: :2funny:
Titre: Re : Vos montures en photos
Posté par: yamoo le 24 avril 2008 à 18:16:20
ouah!!! ça va taquiner grave!!

féloches sphinx!! :top:
Titre: Re : Vos montures en photos
Posté par: Niko le 26 avril 2008 à 20:26:26
Et voici ma titine pour ceux qui ne la connaissent pas ... (la majorité de LM, voir la totalité lol)

( ( (
Titre: Re : Vos montures en photos
Posté par: costaud le 30 avril 2008 à 19:36:26
Bon je me décide quand même mettre les motos qui m'ont et me régale encore aujourd'hui...

Alors pour commencer: mon Hornet de 98 (celle avec la jante avant en 16pouces avec le pneu qui me coutait une fortune  :dead: ) je l'ai gardé 2 ans et que du bonheur.

 ( (

avec une peinture complète jaune nacré (et oui une petite chute)
( (

et puis un GEX750 de 2003 full origine (et full power mais chutttt) :P

( (

et petit à petit bulle noire, échappement, cligno, passage de roue... et

et dernièrement pour fêter ces 5ans et ces 4 ans de bon et loyaux services a mes cotés je lui ai changer de couleur...  >:D

( (
( (
( (
( (

Personnellement j'adore  :love: :love:
Titre: Re : Vos montures en photos
Posté par: zekoala le 30 avril 2008 à 20:01:10
Restons du côté obscur de la force... et voici donc ma mienne quasi terminée (y me reste plus qu'à trouver une tête de fourche).



Content je suis de mon travail après... 2 mois de taff le midi et le soir par ci par là.
Titre: Re : Vos montures en photos
Posté par: Ravage le 30 avril 2008 à 20:37:07
A zekoala :
je me rappel pas etre monter sur cette moto apres ma chute  :2funny: ( n est pas zekoala )
n empeche tu as fai un joli travail
Titre: Re : Vos montures en photos
Posté par: ReedSmith le 30 avril 2008 à 21:13:08
nice job  :top: :top:
Titre: Re : Vos montures en photos
Posté par: juju le 02 mai 2008 à 20:07:04
mes jouets avec les peinture " de guerre"  ;D ;D




Titre: Re : Vos montures en photos
Posté par: zekoala le 02 mai 2008 à 20:18:03
hé l'autre hé !
Pourquoi qu'il a collé des autocollants KTM sur sa brêle... ça fait moche...

Titre: Re : Vos montures en photos
Posté par: ritchie le 02 mai 2008 à 20:37:57
Ahhhh la Katoch me fait envie. Vive le 2t. :love:
En tous cas jolies brèles :top:
Titre: Re : Vos montures en photos
Posté par: juju le 02 mai 2008 à 20:51:55
Vive le 2t. :love:
copain !!!!!
Titre: Re : Vos montures en photos
Posté par: ritchie le 02 mai 2008 à 21:01:34
Vive le 2t. :love:
copain !!!!!

Je rève d'en avoir une. Un CR500 ne serait pas pour me déplaire non plus ou en plus vieu un 750H2 Kawa. 8)
Titre: Re : Vos montures en photos
Posté par: steven69 le 03 mai 2008 à 17:32:36
voici mon 750

( (

Titre: Re : Vos montures en photos
Posté par: mat69.lyon le 03 mai 2008 à 18:23:44
Et voici mon Faz:
( (
( (
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 03 mai 2008 à 18:34:27
Très classe ton Faz'  :top:
Titre: Re : Vos montures en photos
Posté par: damsR6 le 03 mai 2008 à 18:47:09
mais je le connais ca faz', oh oui je le connais.

il es nickel ce faz', et tu la acheter a un maniaque je peu te le garantir.
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 03 mai 2008 à 19:03:16
C'est l'ancien d'oliv. il me semble. ???
Titre: Re : Vos montures en photos
Posté par: NeNe le 03 mai 2008 à 19:05:49
C'est l'ancien d'oliv. il me semble. ???

me dis la même chose, ou alors quelqu'un à eu la même merveilleuse idée, elle y ressemble beaucoup !

elle est superbe  ;)
Titre: Re : Vos montures en photos
Posté par: damsR6 le 03 mai 2008 à 19:08:53
je suis prêt a parier, le gars s appel Damien,non ce n est pas moi, mais je suis quasiment sur de mon coup, on attend la reponse de l interessé
Titre: Re : Vos montures en photos
Posté par: mat69.lyon le 03 mai 2008 à 19:22:00
effectivement l'ancien proprio s'appelle Damien, bien vu. :top:
Titre: Re : Vos montures en photos
Posté par: damsR6 le 03 mai 2008 à 19:30:27
alors la t 'a fais une superbe affaire parce que cette moto a ete bichonée.
Titre: Re : Vos montures en photos
Posté par: Varadeyann le 12 mai 2008 à 09:59:35
Voila ma Mobylette.....

( (
Titre: Re : Vos montures en photos
Posté par: patmotard69 le 12 mai 2008 à 10:05:42
voila la mienne !! :)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 12 mai 2008 à 10:13:25
Où ça ??  :D  ;D
Titre: Re : Vos montures en photos
Posté par: patmotard69 le 12 mai 2008 à 10:14:31
je viens de voir que j ai pas reussi a joindre la photo !!! :-[

Edit: affichage des photos.

( (

( (
Titre: Re : Vos montures en photos
Posté par: Renaud le 12 mai 2008 à 11:25:08
Ma vieille poutre... que j'aime. Pour ses 15 ans en octobre je fais une boum... :geek:

( (
Titre: Re : Vos montures en photos
Posté par: lionelpylot le 12 mai 2008 à 12:36:39
Mon petit R1...

( (

Et pour les fans de Ducat', petit souvenir de ma ballade hier à Annecy... sous la flotte... Donc la Ducat S2R de mon pote suisse.

( (
Titre: Re : Vos montures en photos
Posté par: nonox le 12 mai 2008 à 18:53:56
voila ma belle en vacance

( (

en pleine séance de bronzage
( (

et enfin je l'est retrouvé en train de siroté un plein se super avec des copines ;D
( (
Titre: Re : Vos montures en photos
Posté par: Hurl le 13 mai 2008 à 11:16:39
Et voilà la mienne :

Faites pas attention, y'en manque 2 3 morceaux  ::) :D
Titre: Re : Vos montures en photos
Posté par: FLO le 13 mai 2008 à 11:21:00
Et voilà la mienne :

Faites pas attention, y'en manque 2 3 morceaux  ::) :D

Je veux la même....  ;D
Titre: Re : Vos montures en photos
Posté par: doups le 13 mai 2008 à 11:24:43
t'as pas honte de montrer une falco toute nue ?

( (
ma ducati

et la falco en version route
Titre: Re : Vos montures en photos
Posté par: aston le 15 mai 2008 à 01:25:27
Et voila la mienne, oui, je sais, c'est une mobylette a cote des autres, mas faut ce qu'il faut quand on debute.. et j'en suis fier, surtout avec le temps que j'ai passe dessus pour refaire la peinture... 8)

Titre: Re : Vos montures en photos
Posté par: Ravage le 15 mai 2008 à 08:07:14
@aston : elle est plus jolie comme sa que dans sa couleur d avant  :top: :coolsmiley:
et oui tu y a passer du temps mais maintenant je ne suis plus seul motard dans la famille
Titre: Re : Vos montures en photos
Posté par: FLO le 15 mai 2008 à 11:00:15
Elle a presque tout d'une grande sauf le moulin... >:D
Titre: Re : Vos montures en photos
Posté par: thanatos69 le 17 mai 2008 à 10:16:04
voila mon acquisition de hier soir...  :D
( (
Titre: Re : Vos montures en photos
Posté par: Gouroups le 17 mai 2008 à 10:19:14
:top: Félicitations l'Homme de la Montagne. ;D

Gex Popopowaaaaaaa. :top:


Amicalement, gOurOups.
Titre: Re : Vos montures en photos
Posté par: thanatos69 le 17 mai 2008 à 10:20:21
merki monsieur orange !  ;)
Titre: Re : Vos montures en photos
Posté par: mag le 17 mai 2008 à 10:20:43
félicitation aranaud :top: :top: :top: :top: :top: :top: :top:
fais toi plaisir mais soit prudent ;)
Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 17 mai 2008 à 13:40:27
et de 3 au moins sur le forum.

Félicitations, l'a un très joli museau.  :love:
Titre: Re : Vos montures en photos
Posté par: david711 le 18 mai 2008 à 00:32:39
voici la mienne hayabusa k8 orange et noire avec pot yosh r77 + tre ca pete  ;)

( (
Titre: Re : Vos montures en photos
Posté par: Ben le 18 mai 2008 à 01:34:52
Feloche Thanatos! :top:

David711 Sympa les pots mais je n'adhère pas au nouveau cul de l'haya... Ca reste tout de même une sacré brèle! :coolsmiley:
Titre: Re : Vos montures en photos
Posté par: lionelpylot le 18 mai 2008 à 02:35:49
Superbe le Gex Arnaud, reste plus qu'à virer la vilaine bavette derriere et changer le pot...
Titre: Re : Vos montures en photos
Posté par: Gouroups le 18 mai 2008 à 06:11:06
voici la mienne hayabusa k8 orange et noire avec pot yosh r77 + tre ca pete  ;)

( (

Rââââââââââ !!! So Lovely. :love: :love: :love: :love: :love: :love: :love:

Je me verrai bien sur ce genre de grosse bête pour faire (plus tard) la transition entre un T'Gex et un truc plus pèpère. (bcp plus tard)
Titre: Re : Vos montures en photos
Posté par: blab le 19 mai 2008 à 01:04:49
Allez, re' sur ce post !

Titre: Re : Vos montures en photos
Posté par: Gouroups le 19 mai 2008 à 06:46:49
Allez, re' sur ce post !

Râââââ, tu veux me tuer ? :2funny:
Titre: Re : Vos montures en photos
Posté par: nittaku le 21 mai 2008 à 19:43:47
ma nouvelle monture  :)

( (
Titre: Re : Vos montures en photos
Posté par: Aramislyon le 21 mai 2008 à 22:10:36
Mon Inaz 750, y'a une dizaine de jours au col de la Croix Morand (1401 m), au dessus du lac de Chambon...

Titre: Re : Vos montures en photos
Posté par: Ben le 22 mai 2008 à 00:44:25
Une nouvelle fois sur ce forum mais je ne m'en lasse pas.

Titre: Re : Vos montures en photos
Posté par: Ptitducky le 22 mai 2008 à 08:17:55
Euh...le garde boue à l'arrière, c'est plus décoratif qu'autre chose, non ?  ??? parce que je doute que l'on puisse faire plus petit ;D ;D

PS 1 : bon, depote bien ?

PS 2 : bon alors c'est quand que l'on peut l'essayer.... ::)
Titre: Re : Vos montures en photos
Posté par: Ben le 22 mai 2008 à 08:37:51
Le "lèche roue" est petit c'est vrai. Il était dessus et c'est mieux que rien. J'allais pas le virer. :geek:

Pour l'essai => Ducati Dardilly => caution => modèle 2008 ou modèle S 2008 à l'essai. >:D
Quand tu as troqué ta fazouille pour un R6 je n'ai pas entendu parler "d'essai"... ::)

Pour la rince dès que j'ai plus cette fichue crève JE RINCE. :dead: (même si on en a déja fait une petite entre nous en la ramenant. :2funny: ;) )
Titre: Re : Vos montures en photos
Posté par: Rems le 25 mai 2008 à 18:03:19
Et voici ma Ducati ST3 "S" acquise récemment  :D






Titre: Re : Vos montures en photos
Posté par: Ben le 25 mai 2008 à 18:30:31
Très sympa dans ce coloris!  :top:
Titre: Re : Vos montures en photos
Posté par: Rems le 25 mai 2008 à 19:11:23
Très sympa dans ce coloris!  :top:

Merci Ben  :)
Son coloris est donc Gris Senna, et c'est un modèle unique avec son cadre rouge  :love:
Titre: Re : Vos montures en photos
Posté par: Ben le 25 mai 2008 à 19:13:37
Comme le 1000SS gris senna!!!  :top:

Dit donc toi les palmiers tu les as trouvé ou? >:D
Titre: Re : Vos montures en photos
Posté par: Rems le 25 mai 2008 à 19:16:16
Comme le 1000SS gris senna!!!  :top:

Dit donc toi les palmiers tu les as trouvé ou? >:D

à Antibes bien sur  >:D
Titre: Re : Vos montures en photos
Posté par: X-Off le 25 mai 2008 à 21:25:08

Et voilà ma nouvelle acquisition, c'est celle de diabolo69 mais je lui ai mis de nouvelles chaussettes (pilot road 2 derrière et pilot power devant!!!)

Dommage que la pluie m'ai empêché de les roder!!! putain de temps!!!!

d'ailleurs est-ce que qq aurait le saute vent suz d'origine?
Titre: Re : Vos montures en photos
Posté par: Ben le 25 mai 2008 à 21:39:28
Félicitations! ;) Rouge, Bicylindres, japonaise... passons...  :top: :coolsmiley:
Titre: Re : Vos montures en photos
Posté par: pop69 le 25 mai 2008 à 21:50:45
voila mon acquisition de hier soir...  :D
( (

qu'est-ce-que c'est beau un gex :love: :love: :love: :_cheesy:
Titre: Re : Vos montures en photos
Posté par: FLO le 25 mai 2008 à 22:57:19
voila mon acquisition de hier soir...  :D
( (

qu'est-ce-que c'est beau un gex :love: :love: :love: :_cheesy:

Vendu va.... ::)
Titre: Re : Vos montures en photos
Posté par: Bradpote le 26 mai 2008 à 04:57:55
ma nouvelle monture  :)

( (

Felicitations Fabien, le Bi en tenue de combat camouflé en embuscade  :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: blab le 28 mai 2008 à 00:21:00

Et voilà ma nouvelle acquisition, c'est celle de diabolo69 mais je lui ai mis de nouvelles chaussettes (pilot road 2 derrière et pilot power devant!!!)

Dommage que la pluie m'ai empêché de les roder!!! putain de temps!!!!

d'ailleurs est-ce que qq aurait le saute vent suz d'origine?

Oh le con !!! Félicitations m'sieur !  Va vraiment falloir qu'on aille rouler hein ?!
PS : je suis quand meme rassuré de voir qu'il n'y a que la couleur de Ducat'  >:D
Titre: Re : Vos montures en photos
Posté par: Ben le 28 mai 2008 à 00:38:41

PS : je suis quand meme rassuré de voir qu'il n'y a que la couleur de Ducat'  >:D
Blab fait pas ton connaisseur t'es resté trop longtemps piéton pour être crédible.  >:D

>:D >:D >:D >:D >:D
Titre: Re : Vos montures en photos
Posté par: thanatos69 le 28 mai 2008 à 08:47:54
voila mon acquisition de hier soir...  :D
( (

qu'est-ce-que c'est beau un gex :love: :love: :love: :_cheesy:

et encore, avec une photo mieux prise, c'est mieux ! regardes...
( (
Titre: Re : Vos montures en photos
Posté par: TroLiTo le 28 mai 2008 à 08:59:49
Fais lui respirer l'air pur de la nature  ;D la mienne adore... pour les détraqueurs : je l'ai poussé dans l'herbe, hein ! c'est pas une kawa  :2funny:

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 28 mai 2008 à 11:47:09
Mouais, bah pousse la pas de trop hein, c'est pas un ravin qu'on voit en contre bas vers les arbres ??  :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: Hurl le 28 mai 2008 à 16:53:12
Demandes à Cardi, il doit bien savoir lui :D
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 28 mai 2008 à 17:05:01
et encore, avec une photo mieux prise, c'est mieux ! regardes...
( (
C'est pas au haut du Mt Verdun cette photo ??? ??
Titre: Re : Vos montures en photos
Posté par: thanatos69 le 28 mai 2008 à 21:40:26
et encore, avec une photo mieux prise, c'est mieux ! regardes...
( (
C'est pas au haut du Mt Verdun cette photo ??? ??

alors ne sais pas...j ai erré du cote de courzieupas la moindre idee d ou j etais...
Titre: Re : Vos montures en photos
Posté par: Vive_moi le 01 juin 2008 à 09:41:30

Voici donc mon ZZ-R.
Année : 2001
Couleur : Champagne/Gris
Kilométrage : 34000 km


D'autres photos : > là < (

A plus tard

Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 01 juin 2008 à 14:27:41
Jolie couleur !  :top:
Titre: Re : Vos montures en photos
Posté par: Vive_moi le 01 juin 2008 à 14:54:01
Merci, j'aime assez aussi. ;)
Titre: Re : Vos montures en photos
Posté par: Davagusta le 01 juin 2008 à 15:43:45
Voici la petite Mamie qui me promène actuellement  :)



C'est con, c'est un vieille brêle de 15 ans ce mois mais je l'adore !!
Titre: Re : Vos montures en photos
Posté par: Gouroups le 01 juin 2008 à 16:04:00
L'époque où les GROSSES Cylindrées avait encore l'air de grosse cylindrée. :top:
Titre: Re : Vos montures en photos
Posté par: Caliméro le 01 juin 2008 à 19:47:42
voila ma titine qui a bientot 42000 bornes

( (
Titre: Re : Vos montures en photos
Posté par: zekoala le 01 juin 2008 à 20:27:44
L'époque où les GROSSES Cylindrées avait encore l'air de grosse cylindrée. :top:
+1 !!! j'aime !

@dav : j'adore ta plaque, tu l'as trouvée où?  :2funny:
Titre: Re : Vos montures en photos
Posté par: FLO le 02 juin 2008 à 18:42:53
j'adore ta plaque, tu l'as trouvée où?

Elle sera pour quelqu'un un jour cette plaque, et dans pas longtemps en plus...
Titre: Re : Vos montures en photos
Posté par: nanga le 03 juin 2008 à 11:23:40
voila mon SV, au dessus d'ampuis

Titre: Re : Vos montures en photos
Posté par: zekoala le 03 juin 2008 à 12:35:36
les photos sont sympa ;) jolie lumière.
Titre: Re : Vos montures en photos
Posté par: adrien le 03 juin 2008 à 19:26:53

mon 500 cr avec le cadre noir  ::)


Titre: Re : Vos montures en photos
Posté par: Silent Phong le 03 juin 2008 à 19:28:26
Il lui manque la roue avant coordonnée à l'arrière, en noire et à rayons ...
Titre: Re : Vos montures en photos
Posté par: nanga le 03 juin 2008 à 22:30:48
les photos sont sympa ;) jolie lumière.

merci mais j'ai pas retouché la photo c'était plus un coup de bol par rapport au contre jour  :geek:
Titre: Re : Vos montures en photos
Posté par: Thieb le 05 juin 2008 à 17:26:22


Titre: Re : Vos montures en photos
Posté par: Silent Phong le 07 juin 2008 à 02:55:19
marche po le lien  :(
Titre: Re : Vos montures en photos
Posté par: harold le 07 juin 2008 à 10:16:21
Mon nouveau Frelon  ;)

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: nordicus le 07 juin 2008 à 18:45:34
bon j ai pas tous lu, 69 pages trop long
mais voici la mienne

enfant illégitime d un monstro et une SV650 C est ...


 a ma prochaine sorti ensoleiler d autre photo
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 07 juin 2008 à 19:09:59
Pas commun chez nous comme moto  :D
Titre: Re : Vos montures en photos
Posté par: NeNe le 07 juin 2008 à 22:55:56
calir, moi j'ai toujours adoré la grande soeur mais le modele V ! Chassis italien avec moteur du TL1000S  :love:

Titre: Re : Vos montures en photos
Posté par: Z1000-77 le 08 juin 2008 à 00:24:45
Voilà enfin une photo de ma nouvelle monture (
Désolé j'arrive pas à afficher l'image :-\ .

Titre: Re : Vos montures en photos
Posté par: silver32 le 08 juin 2008 à 00:32:13
Je crois pas avoir mis de photo de la mienne :

En corse.

( (
Titre: Re : Vos montures en photos
Posté par: nordicus le 08 juin 2008 à 09:09:54
calir, moi j'ai toujours adoré la grande soeur mais le modele V ! Chassis italien avec moteur du TL1000S  :love:


tous a fais d accord avec toi, mais a l heure actuel je n est pas le niveau pour un tel engin et pas l argent

pour le 650, sauf erreur de ma part, c est le même châssis (diamètre de cadre légèrement inférieur) que la 1000 mais taille de pneu inférieur de 180 a 160

voir lien: (
Titre: Re : Vos montures en photos
Posté par: Z1000-77 le 08 juin 2008 à 14:55:53
Voilà enfin une photo de ma nouvelle monture (
Désolé j'arrive pas à afficher l'image :-\ .

Merci pour l'affichage de la photo :top:
Titre: Re : Vos montures en photos
Posté par: TITIZ69 le 09 juin 2008 à 10:16:07
Gex Powaaaaa   >:D

( (

( (

( (

 :love: :love: :love: :love: :love: :love: :love: :love: :love: :love: :love: :love: :love: :love: :love: :love:
Titre: Re : Vos montures en photos
Posté par: Ben le 09 juin 2008 à 11:38:42
@Titiz: Pas de coté obscur de la force mais :top: :top: :top: quand même!
Titre: Re : Vos montures en photos
Posté par: Caliméro le 09 juin 2008 à 21:28:12
elle est superbe titiz  :top: :top:

gex powaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 09 juin 2008 à 21:45:01
Félicitations !  :D
Titre: Re : Vos montures en photos
Posté par: factory le 12 juin 2008 à 08:00:33
Voilà mes jouets.....



 :coolsmiley: :coolsmiley:
Titre: Re : Vos montures en photos
Posté par: TL1000R le 12 juin 2008 à 18:19:44
voilà mes miennes, l'ancienne et la nouvelle  8)

la nouvelle sans les modifs (bulle double noire + leovince carbones + ....)
( (

l'ancienne dans son jus à la revente  :(

( (

Titre: Re : Vos montures en photos
Posté par: NeNe le 12 juin 2008 à 20:54:01
je prefere la nouvelle  :love: :love:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 12 juin 2008 à 20:57:37
Ouaip !
quand elle est sortie je la trouvais maxi moche, et maintenant je la trouve superbe !!  ;D
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 13 juin 2008 à 03:48:01
J'ai toujours aimé le TL 1000 R comme le poster que j'avai au dessus de ma porte de chambre d'ado prébubère.Vous l'aviez aussi à côté de celui de la Ducat' Senna.


J'voulais un posté plusieurs mais non !! Mauvaise idée !
Juste un lien alors

Titre: Re : Vos montures en photos
Posté par: guillaume le 13 juin 2008 à 09:56:08
Trop beau le TL1000R. Mythique comme la ZX-7R.  :love:
Titre: Re : Vos montures en photos
Posté par: Winnie le 13 juin 2008 à 11:37:23
rhaaa la ZX-7R j'adore  :love: :love: :love:
Titre: Re : Vos montures en photos
Posté par: denver le 13 juin 2008 à 15:15:36
Comme quoi un SV de 2005 ca casse bien !!!!!!!!! voici la mienne mdr :top:



Titre: Re : Vos montures en photos
Posté par: ChoCoPunX le 13 juin 2008 à 15:18:05
J'aime bien les motos rabaissées de l'avant.... mais là ça fait trop  :dead:

Comment tu t'es démerdé pour faire ça?  ???
Titre: Re : Vos montures en photos
Posté par: denver le 13 juin 2008 à 15:23:42
il a suffi d'un co...d pour me coupé la route..... et hop un tour un val rosay hihi....

J'aime bien les motos rabaissées de l'avant.... mais là ça fait trop  :dead:

Comment tu t'es démerdé pour faire ça?  ???
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 13 juin 2008 à 17:42:46
Val Rosay, j'ai mon pote Damien qui avait reservé une chambre là-bas  :dead:
Titre: Re : Vos montures en photos
Posté par: Davagusta le 13 juin 2008 à 18:15:28
j'adore ta plaque, tu l'as trouvée où?

Elle sera pour quelqu'un un jour cette plaque, et dans pas longtemps en plus...

je l'ai acheté avec un lot de points de permis !! mdr
Titre: Re : Vos montures en photos
Posté par: DIDIER30 le 13 juin 2008 à 21:09:37
voici ma motobylette, qui est en vente en attendant ma future (triumph tiger)
Titre: Re : Vos montures en photos
Posté par: magicfr le 18 juin 2008 à 11:57:09
Mon BIOULE/motoculteur :)


Le reste ici :)
Titre: Re : Vos montures en photos
Posté par: MaxB le 18 juin 2008 à 22:10:45
Zoli la Buell...............

J'ai un peu honte de mettre mon tout nouveau jouet après ça mais bon..........
Faut se dire que c'est une bonne base pour en faire quelque chose de mieux           ;)     En tout cas c'est Super Marrant de rouler avec un machin comme ça             :2funny:



Je compte d'ailleurs sur vous pour me donner qlq idées et qlq conseils / adresses pour une peinture         ;)
Titre: Re : Vos montures en photos
Posté par: nonox le 30 juin 2008 à 23:17:42
et voila ma nouvelle maitresse
( (
Titre: Re : Vos montures en photos
Posté par: JoChaps le 01 juillet 2008 à 10:24:42
Huummm, dans la famille Suz GSX-R, je demande la petite soeur !  :top:


Vous reconnaitrez surement la moto puisque l'ancien papa est d'ici  ;)

PS: d'autres photos ici (
Titre: Re : Vos montures en photos
Posté par: panik le 01 juillet 2008 à 12:22:44
Voilà quelques photos de ma mémère.

Cet hiver, chez moi en Auvergne:

( (

( (

Lors de ma première journée sur piste au circuit d'Issoire, que du bonheur!

( (

Et pour finir, chirurgie avec Photofiltre.

( (
Titre: Re : Vos montures en photos
Posté par: Gouroups le 01 juillet 2008 à 13:16:31
Waaaaaaaaaaaaaaaaa  :o

La roue arrière sans écrou.
:top: :2funny:

Et la future modif tuninje à la mode : La casquette de phare pour moto.

Allez, je rigole. @+ ;)

Amicalement, gOurOups.
Titre: Re : Vos montures en photos
Posté par: JoChaps le 01 juillet 2008 à 15:41:12
humm la photo a pas l'air de vouloir s'afficher...  :idiot:

donc re :

Titre: Re : Vos montures en photos
Posté par: panik le 01 juillet 2008 à 16:08:43
Waaaaaaaaaaaaaaaaa  :o

La roue arrière sans écrou.
:top: :2funny:

Et la future modif tuninje à la mode : La casquette de phare pour moto.

Allez, je rigole. @+ ;)

Amicalement, gOurOups.
T'as remarqué le moteur qui lévite dans le cadre? Rare! :D

Sinon, oui, les paupières de phares vont faire un carton, je lance d'ailleurs ma boite, j'en ai de très belles pour Gex, comme ça t'y verras que dalle la nuit, et t'auras un bonne excuse si tu te fais poudrer par tes potes! Elle est pas belle la vie?

Titre: Re : Vos montures en photos
Posté par: cuarved le 01 juillet 2008 à 17:02:19
Et le cylindre avant, il est relié comment sur le pot ?  :geek:
Titre: Re : Vos montures en photos
Posté par: ZedMed le 01 juillet 2008 à 22:53:30
Hey Jo, c'est la première fois que je la vois propre cette Gex...  :2funny: :2funny:

Busker si tu me lit... :-* :D
Titre: Re : Vos montures en photos
Posté par: MMM le 02 juillet 2008 à 10:54:32
voila la mienne (
je l ai depuis mars c ma premiere moto!
donc je la prend en main doucement lol

en esperant bientot pouvoir faire des balades avec vous!

a bientot
Titre: Re : Vos montures en photos
Posté par: Jean-lio le 05 juillet 2008 à 20:47:30
Et Voici Ma Z750 S

Beaucoup détestent la fourche du S, mais moi j'adore et le cul en plus ....... hmmmmm

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 06 juillet 2008 à 02:32:36
Et voilà le destrier que j'ai récupéré hier soir  :)

( (
( (
( (
( (
( (
( (
( (
( (
( (
Année 2000, 43 000kms, et toujours tout son charme  :coolsmiley:

Encore merci à ceux que j'ai harcelé de questions  ;)
Titre: Re : Vos montures en photos
Posté par: Ben le 06 juillet 2008 à 11:27:48
Une européenne j'aurais tendance a dire que tu progresses! >:D
Enfin en en avait parlé! J'préfere ce cul la. Et la couleur est bien choisie! Habillage noire; cadre et gente grise.  :coolsmiley:
La roue AR est superbe! :o
Félicitation! Et fait toi plaisir!
Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 06 juillet 2008 à 11:54:11
J'en entends déjà te dire que les noires roulent plus vite ...  ;D

Retour au roadster ?! Félicitations pour ta nouvelle machine.
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 06 juillet 2008 à 12:04:07
J'en entends déjà te dire que les noires roulent plus vite ...  ;D

Retour au roadster ?! Félicitations pour ta nouvelle machine.

Oui retour au roadster, c'est principalement ce qui m'a décidé à changer. Je préfère les roadsters (si possible musclés  >:D ). J'avais pris le VTR pour m'essayer à la sportive (et encore ce n'est pas une pure sportive radicale), mais ma préférence revient au grand guidon  :top:
Titre: Re : Vos montures en photos
Posté par: NeNe le 06 juillet 2008 à 12:25:25
 :top: :top: :top: :top: troooooooooop belle !

félicitations Martial  :) ;)
Titre: Re : Vos montures en photos
Posté par: greg le 06 juillet 2008 à 13:36:07
Félicitations  :top: encore un speed  :-X ;D
Titre: Re : Vos montures en photos
Posté par: flip69 le 06 juillet 2008 à 20:33:29
Râââhhhh...exactement le modèle que je cherche depuis (trop?) longtemps!!!...l'année, la couleur...mais comme je disais dans ma prez, "un jour elle sera mienne, oh oui..."   ;D

Par curiosité, quel prix tu l'as payée?...tu peux répondre par MP, si tu es trop pudique!  :P

Bravo en tout cas!  :top:
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 14 juillet 2008 à 20:48:57
( ( ( ( 
What else ? (
Titre: Re : Vos montures en photos
Posté par: playmobike le 14 juillet 2008 à 21:20:28
t'as essayé la sportive.... t'as vu.... t'as pas aimé! ce fut bref mais intense !  :2funny:

Féloches et bon retour au roadster ! :D :top:
Titre: Re : Vos montures en photos
Posté par: Tazette le 05 septembre 2008 à 01:11:58
et voiloù  ;)


depuis le temps que je dois la mettre cette photo  ::)
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 05 septembre 2008 à 08:20:10
bouuuhhh le vilain carter tout sale........ :P :P :P :P
Titre: Re : Vos montures en photos
Posté par: Tazette le 05 septembre 2008 à 08:24:11
bouuuhhh le vilain carter tout sale........ :P :P :P :P

je t'attends toujours pour l'étape nettoyage  ;)

saloupiod va!
Titre: Re : Vos montures en photos
Posté par: sphinx le 05 septembre 2008 à 08:31:06
moi ce que je préfère c'est le pot remus façon KéKé style...  >:D :2funny:

avec le rouge ferrari, c'est le combo special jacky !  ;D ;D ;D

néanmoins elle reste sympa cette petite ER5  :)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 05 septembre 2008 à 20:27:29
Heyyy mais y'a même un guidon cross façon stunt  :D  >:D
Sinon, à part ce carter, je le trouve propre l'engin !!  :)
Titre: Re : Vos montures en photos
Posté par: Tazette le 08 septembre 2008 à 21:56:20
Pour les vilains ( :gourdin:) le pot et le guidon étaient dessus quand je l'ai achetée.... j'ai juste fait remettre un phare d'origine, fait faire une selle perso et rajouté le sabot...

Pour ce qui est du carter, faudrait que je m'y mette  ::)

Titre: Re : Vos montures en photos
Posté par: tite motarde le 10 septembre 2008 à 10:57:56
nouvelle sur le forum donc voila ma belle :

Titre: Re : Vos montures en photos
Posté par: mat69.lyon le 23 septembre 2008 à 06:42:34
Sympa en street aussi, très belle machine Pim's  :top:
Titre: Re : Vos montures en photos
Posté par: mva38 le 26 septembre 2008 à 12:16:00
( ( (
met deux joujoux >:D >:D >:D >:D
Titre: Re : Vos montures en photos
Posté par: Jazz le 06 octobre 2008 à 18:39:42
nouvelle sur le forum donc voila ma belle :


Hello ! (désolé, je ne t'ai pas souhaité la bienvenue encore).
C'est marrant mais ce guidon street, cette tête de fourche et ce pot Mig me font penser à la bécane d'un ancien membre de LM, -Flo-.
J'ai juste ?
Titre: Re : Vos montures en photos
Posté par: jolop le 13 octobre 2008 à 08:55:35
Salut, après un petit passage chez Kawa, me voici de retour chez Yam

ma nouvelle monture hier


et aujourd'hui

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 13 octobre 2008 à 09:54:06
Bien belle acquisition ma vieille truffasse décrépie  :top: !!!
Titre: Re : Vos montures en photos
Posté par: jmf69150 le 13 octobre 2008 à 13:04:45
  c'est vraiment une belle machine  :top: félicitation
Titre: Re : Vos montures en photos
Posté par: ReedSmith le 13 octobre 2008 à 13:10:03
Superbe  :top:
Va falloir mettre ce bandeau à jour maintenant  ;)
Titre: Re : Vos montures en photos
Posté par: jolop le 13 octobre 2008 à 18:04:40
aussitôt dit, aussitôt fait  :geek: :geek:
Titre: Re : Vos montures en photos
Posté par: NeNe le 13 octobre 2008 à 21:07:19
Sublimissime mon JO !  :top:
Titre: Re : Vos montures en photos
Posté par: juju le 15 octobre 2008 à 12:36:40
belle becanne jolop

c'est moi le collegue de ton frere qui roule en supermot  ;)
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 15 octobre 2008 à 18:38:47
Pinaise Jo ! Ze class !
Féloch !
Elle est magnifique  :top:
Titre: Re : Vos montures en photos
Posté par: jolop le 15 octobre 2008 à 19:48:52
belle becanne jolop

c'est moi le collegue de ton frere qui roule en supermot  ;)

c'est quand tu veux pour une sortie piste. ' a condition que tu me pourrisses pas car mon frère va m'engueuler )  :top: :top:
Titre: Re : Vos montures en photos
Posté par: denver le 15 octobre 2008 à 20:11:01
après le "svtoucasser" le "cbrtoutpourris" voici gexou le retour.....

Titre: Re : Vos montures en photos
Posté par: ZUM69 le 15 octobre 2008 à 20:12:53
Ouahhhh  :top:
C'est ma mienne mais avec un gros moteur  :geek:
Titre: Re : Vos montures en photos
Posté par: denver le 15 octobre 2008 à 20:54:41
Ouahhhh  :top:
C'est ma mienne mais avec un gros moteur  :geek:

vivi toi aussi en black?
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 15 octobre 2008 à 20:55:45
Bel engin, y'a pas à dire  :top:

Mais ce noir, c'est devenu d'un classique !!  ::)
Titre: Re : Vos montures en photos
Posté par: FLO le 15 octobre 2008 à 21:18:30
Bel engin, y'a pas à dire  :top:

Mais ce noir, c'est devenu d'un classique !!  ::)

C'est sur, si j'avais su j'aurais fait peindre en rose... :geek: ;D
Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 15 octobre 2008 à 21:37:52
Joli Jolop  :top:

et félicitataions denver.  :D
Titre: Re : Vos montures en photos
Posté par: Gouroups le 15 octobre 2008 à 21:43:57
Yooooooooo Denver, :top:

T'Gex sera très heureuse de rouler avec Gexxou.

Mais, vire moi ces vilains pots tout kAkA, tu veux nous foutre la honte ou quoi ? :2funny:

Titre: Re : Vos montures en photos
Posté par: denver le 15 octobre 2008 à 23:00:34
Yooooooooo Denver, :top:

T'Gex sera très heureuse de rouler avec Gexxou.

Mais, vire moi ces vilains pots tout kAkA, tu veux nous foutre la honte ou quoi ? :2funny:


t'inquiete!! GEXOU attend 2 jolies pot leo evo II carbone qui vont dechirer, mais leo a du retard dans la livraison... snif :'(
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 15 octobre 2008 à 23:41:47
Et ben dis donc, depuis l'époque d'achat "forcé" du cbrtoutpourris, t'as du choper les bons numéros à l'euromillion toi  >:D
Titre: Re : Vos montures en photos
Posté par: adrien le 16 octobre 2008 à 07:45:47
mon nouveau jouet un 750 gsxr de 89  vu que j'ai tjs pas gagné au loto  :geek:



Titre: Re : Vos montures en photos
Posté par: Ptitducky le 16 octobre 2008 à 08:25:35
Il etait pas bien le 1100? ::)

par contre pense à mettre un pot...parce que là... ::) et une platine droite aussi... ::)

C'est quoi le supermot demonté au fond du garage ? ???
Titre: Re : Vos montures en photos
Posté par: adrien le 16 octobre 2008 à 13:16:33
Il etait pas bien le 1100? ::)

par contre pense à mettre un pot...parce que là... ::) et une platine droite aussi... ::)

C'est quoi le supermot demonté au fond du garage ? ???

j'ai casser le moteur du 1100 et oui derriere c'est mon petit supermot qui sera surement en vente une fois réparé
Titre: Re : Vos montures en photos
Posté par: jolop le 24 octobre 2008 à 20:37:22
qlqes petites modifs sur mon velo  ;D ;D

Titre: Re : Vos montures en photos
Posté par: guillaume le 24 octobre 2008 à 20:59:24
qlqes petites modifs sur mon velo  ;D ;D


Pitain j'en ai foutu plein mon bénard.........  >:D >:D >:D

 :love: :love: :love:
Titre: Re : Vos montures en photos
Posté par: jolop le 25 octobre 2008 à 08:01:15
Merci Guigui, mais moi aussi même à mon age  :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 25 octobre 2008 à 21:52:38
C'est vrai qu'elle est belle !!!  :top:
Titre: Re : Vos montures en photos
Posté par: flo 69 le 26 octobre 2008 à 17:09:48
voila mon tit bandit pas encore de modif...
Titre: Re : Vos montures en photos
Posté par: miloose69 le 26 octobre 2008 à 18:16:27
trop bo le bandit furtif :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: flo 69 le 26 octobre 2008 à 18:35:19
voila( (
( (
Titre: Re : Vos montures en photos
Posté par: FLO le 26 octobre 2008 à 20:08:11
Toujours invisible... :)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 26 octobre 2008 à 20:56:42
Je me demande si c'est le site ou imageshack mais il semble y avoir un bug  :dead:
Titre: Re : Vos montures en photos
Posté par: FLO le 26 octobre 2008 à 21:01:42
Moi j'avais que des soucis avec ImageShack, je suis passé sur Casimages et plus de problèmes depuis... :top:
Titre: Re : Vos montures en photos
Posté par: manuktm le 26 octobre 2008 à 23:47:05
J ai fait une jolie photo avant de la vendre ;)  Juste avec des jeux de lumiere sans truquage ;)

Titre: Re : Vos montures en photos
Posté par: jolop le 28 octobre 2008 à 06:45:27
plus belle que neuve  :top:
Titre: Re : Vos montures en photos
Posté par: vincent le 28 octobre 2008 à 07:52:10

la classe !  :top:

comme dit Jolop, plus belle que neuve !
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 29 octobre 2008 à 19:39:35
Bel effet !  :top:
Titre: Re : Vos montures en photos
Posté par: gregsp le 29 octobre 2008 à 19:57:00
J ai fait une jolie photo avant de la vendre ;)  Juste avec des jeux de lumiere sans truquage ;)


elle est tres belle!
c'est quoi comme marque tes retros? ils mont l'air bien sympa et apparement assez large pour que l'on y voit quelque chose dedans!
Titre: Re : Vos montures en photos
Posté par: Ben le 29 octobre 2008 à 20:06:53
J ai fait une jolie photo avant de la vendre ;)  Juste avec des jeux de lumiere sans truquage ;)


Riiiinnnnn !!!! Tu passes à autre chose?  >:D >:D >:D
Titre: Re : Vos montures en photos
Posté par: manuktm le 29 octobre 2008 à 20:12:39
Merci pour les compliments !! Je suis en effet tres fier de ma photo! Je vais me présenter chez suz pour faire la promotion des nouvelles motos!!  Avec une image pareil obligé de tombé sous le charme  :idiot: :idiot: :2funny:

J ai fait une jolie photo avant de la vendre ;)  Juste avec des jeux de lumiere sans truquage ;)


elle est tres belle!
c'est quoi comme marque tes retros? ils mont l'air bien sympa et apparement assez large pour que l'on y voit quelque chose dedans!

nan on y voit que dal !! ou alors il faut serrer les bras.

Je crois que c est des slide de chez bihr. J l ai ai acheter il y a un moment, deux marque les commercialisent. Une a 80 € env et l autre à 55 € env. ;)
Posté le: 29 Octobre 2008 à 20:11:03

J ai fait une jolie photo avant de la vendre ;)  Juste avec des jeux de lumiere sans truquage ;)

Riiiinnnnn !!!! Tu passes à autre chose?  >:D >:D >:D

Ouai. Je vais chopper un trois pattes...  Moi je fais dans l ordre! Les monos, le bi, le tri.... Un de ces quatres j acheterais ptet un 4 ctlindres ;)
Titre: Re : Vos montures en photos
Posté par: nittaku le 30 octobre 2008 à 09:01:57
pour rester dans le style...

ma monture au coin du feu, dans le vercors  :love:

Titre: Re : Vos montures en photos
Posté par: pizzai69 le 30 octobre 2008 à 10:08:57
Dommage, à quelques mètres près c'était nickel  >:D
Titre: Re : Vos montures en photos
Posté par: NeNe le 30 octobre 2008 à 11:39:02
Dommage, à quelques mètres près c'était nickel  >:D

+1  :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: gregsp le 30 octobre 2008 à 18:37:01

J ai fait une jolie photo avant de la vendre ;)  Juste avec des jeux de lumiere sans truquage ;)


elle est tres belle!
c'est quoi comme marque tes retros? ils mont l'air bien sympa et apparement assez large pour que l'on y voit quelque chose dedans!

nan on y voit que dal !! ou alors il faut serrer les bras.

Je crois que c est des slide de chez bihr. J l ai ai acheter il y a un moment, deux marque les commercialisent. Une a 80 € env et l autre à 55 € env. ;)
Posté le: 29 Octobre 2008 à 20:11:03

merci pour ta reponse et encore toutes mes felicitations pour cette belle machine!
et vivement la prochaine  :top:

Titre: Re : Vos montures en photos
Posté par: Ben le 31 octobre 2008 à 11:48:44
Merci Gregsp j'aurais pas dit mieux moi même!  :2funny:
Titre: Re : Vos montures en photos
Posté par: Alain le 31 octobre 2008 à 17:37:48
ma premiere
Titre: Re : Vos montures en photos
Posté par: sphinx le 31 octobre 2008 à 18:22:41
ma premiere

elle s'affichait pas chez moi alors =>


pas mal mais c'etait très avant gardiste pour ton époque déjà...  :geek: >:D :2funny:
Titre: Re : Vos montures en photos
Posté par: Kyung le 31 octobre 2008 à 18:24:49
Dommage, à quelques mètres près c'était nickel  >:D

+1  :2funny: :2funny:

 :2funny: :2funny: :2funny:
les enfoirés, l'est bien ta titine Fab' :2funny:
Titre: Re : Vos montures en photos
Posté par: Alain le 01 novembre 2008 à 06:06:40
ma premiere

elle s'affichait pas chez moi alors =>


pas mal mais c'etait très avant gardiste pour ton époque déjà...  :geek: >:D :2funny:
C'est mon premiere amour acheté en 1981 ;D ;D ;D
Titre: Re : Vos montures en photos
Posté par: cuarved le 01 novembre 2008 à 13:01:31
voila ma dernière...

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 01 novembre 2008 à 13:10:45
Mais vous allez arrêter avec vos motos noires b****l de zut !!!  :vnr:

belle bâââêêête en tout cas !!  ;)
Titre: Re : Vos montures en photos
Posté par: nonox le 01 novembre 2008 à 13:19:47
superbe :top: :top:
Titre: Re : Vos montures en photos
Posté par: FLO le 01 novembre 2008 à 13:21:07
Encore un gex, mais joli quand même... :top:
Titre: Re : Vos montures en photos
Posté par: NeNe le 01 novembre 2008 à 13:31:48
arf exactement celle que je voulai avec les mêmes pots tout pareil... foirééééééé  :geek:

félicitations !
Titre: Re : Vos montures en photos
Posté par: cuarved le 01 novembre 2008 à 13:34:52
Encore un gex, mais joli quand même... :top:

Mon 6ème pour être exact  ;)

arf exactement celle que je voulai avec les mêmes pots tout pareil... foirééééééé  :geek:

félicitations !

Tu as très bon goût Néné ... ;)
Titre: Re : Vos montures en photos
Posté par: guillaume le 01 novembre 2008 à 14:14:11
voila ma dernière...

( (

( (

( (

Bouuuuu la meuto de Ghost Rider  >:D
Titre: Re : Vos montures en photos
Posté par: cuarved le 01 novembre 2008 à 14:19:00
Bouuuuu la meuto de Ghost Rider  >:D

Nan nan  :gourdin:
La moto de Cuarved  :love: :_cheesy: ^-^

A moi !!! A moi !!! A moi !!!
Titre: Re : Vos montures en photos
Posté par: Ravage le 01 novembre 2008 à 14:35:10
Mais vous allez arrêter avec vos motos noires b****l de zut !!!  :vnr:

les motos noires c est les plus rapides  :2funny: :2funny:
je suis deja loin avec ma moto noire
Titre: Re : Vos montures en photos
Posté par: FLO le 01 novembre 2008 à 14:37:25
Mais vous allez arrêter avec vos motos noires b****l de zut !!!  :vnr:

les motos noires c est les plus rapides  :2funny: :2funny:
je suis deja loin avec ma moto noire

A qui le dis tu... :D
( (
Titre: Re : Vos montures en photos
Posté par: denver le 01 novembre 2008 à 15:42:07
Yooooooooo Denver, :top:

T'Gex sera très heureuse de rouler avec Gexxou.

Mais, vire moi ces vilains pots tout kAkA, tu veux nous foutre la honte ou quoi ? :2funny:


t'inquiete!! GEXOU attend 2 jolies pot leo evo II carbone qui vont dechirer, mais leo a du retard dans la livraison... snif :'(

et le voila avec ses deux jolies pot tout neuf !!!!!!!!!!
leovinci EVOII carbone

( (
( (
Titre: Re : Vos montures en photos
Posté par: FLO le 01 novembre 2008 à 15:46:40
C'est quand même mieux, ça c'est sur... :top:
Titre: Re : Vos montures en photos
Posté par: GI-NOX le 01 novembre 2008 à 18:26:32
et le voila avec ses deux jolies pot tout neuf !!!!!!!!!!
leovinci EVOII carbone
( (
( (
Sympa bien que les 2 pots d'avant sont chouettes aussi
Et la chambre de tranquilisation,  elle a sauté? si non C dommage  là y'a du poids à virer !!! :top:
Titre: Re : Vos montures en photos
Posté par: FLO le 01 novembre 2008 à 18:28:10
Sympa bien que les 2 pots d'avant sont chouettes aussi
!!! :top:

Tu déconnes, tu aimes bien les pots d'origine... :o
Titre: Re : Vos montures en photos
Posté par: GI-NOX le 01 novembre 2008 à 18:34:17
Sympa bien que les 2 pots d'avant sont chouettes aussi
!!! :top:

Tu déconnes, tu aimes bien les pots d'origine... :o
non pas ceux d'origine(surtout pas... comme ceux de la Buse etc...), ceux d'avant les GP Yosh de la photo précédente ::)
Posté le: 01 Novembre 2008 à 18:33:00
( (
là  :top:
Titre: Re : Vos montures en photos
Posté par: FLO le 01 novembre 2008 à 18:34:35
Tu me rassures alors... :)
Titre: Re : Vos montures en photos
Posté par: grizzzlyyy le 06 novembre 2008 à 18:37:57
Apres Miss ZZzz...

Aprés Black-Mamba..


::) Voici " Blue Wave " ::)


Fév-2007, 12000 kms.
autonomie entre 170 et 240 km suivant rythme.
Moto fantastique tant par la modernité de son moteur, que par la qualité de la partie cycle comparé au reste de la gamme disponible en roadster. La finition est également au rendez-vous;)
l'absence de TDF donne des sensations de vitesse incroyable (l'impression de se trouver assis sur la fourche en fenwick !). La moto est tres courte sous les fesses ce qui donne une excélente maniabilité en montagne
quelques défauts à prendre en compte :
l'amortisseur arriére qui pompe, la garde au sol, la place sous le capot (j'en avait + sur le GEX), l'usure du pneu arriére (couple de malade INSIDE) :D:.
Pour les modifs :

A venir :

Posté le: 06 Novembre 2008 à 18:35:53
.......des photos :

Titre: Re : Vos montures en photos
Posté par: FLO le 06 novembre 2008 à 18:43:00
Tu n'as que ça comme photos... :D

J'deconne, tres belles machines... :top:
Titre: Re : Vos montures en photos
Posté par: grizzzlyyy le 06 novembre 2008 à 19:06:36
 8) ........ d'autres  >:D






Titre: Re : Vos montures en photos
Posté par: nonox le 07 novembre 2008 à 22:18:42
belles machines  :top:
Titre: Re : Vos montures en photos
Posté par: jmf69150 le 07 novembre 2008 à 22:53:39
 très belle machine, et en plus ya du beau matos dessus félicitation !!!!
Titre: Re : Vos montures en photos
Posté par: ritchie le 08 novembre 2008 à 23:04:41
Voilà ma nouvelle moto depuis ce matin.

( ( (

J'ai plus qu'à apprendre à m'en servir.
Titre: Re : Vos montures en photos
Posté par: Ben le 08 novembre 2008 à 23:22:28
Et a trouver un compteur!

Super meule! J'espère que je me trouverais un vrai supermot' pour faire le con sur piste on pourra comparer comme ça avec ton DR! ;)
Titre: Re : Vos montures en photos
Posté par: ritchie le 08 novembre 2008 à 23:26:42
Et a trouver un compteur!

Super meule! J'espère que je me trouverais un vrai supermot' pour faire le con sur piste on pourra comparer comme ça avec ton DR! ;)

Oui c'est vrai le compteur est parti voir ailleurs  :2funny:
En attendant, compteur de vélo
Titre: Re : Vos montures en photos
Posté par: Ben le 08 novembre 2008 à 23:40:21
Dans tous les cas félicitation! Fait toi plaisir avec! Tu dois être super content!  >:D
Titre: Re : Vos montures en photos
Posté par: ritchie le 08 novembre 2008 à 23:45:26
C'est clair je vais avoir du mal à dormir cette nuit en attendant demain d'aller rouler :D
Titre: Re : Vos montures en photos
Posté par: FLO le 09 novembre 2008 à 00:30:06
Très jolie machine :top: même si je les préfère avec des crampons... >:D

Tu n'as plus qu'a changer ta signature... :)
Titre: Re : Vos montures en photos
Posté par: ritchie le 09 novembre 2008 à 00:35:31
Très jolie machine :top: même si je les préfère avec des crampons... >:D

Tu n'as plus qu'a changer ta signature... :)

Merci ;)
T'as raison, j'avais pas pensé à la signature, je vais changer ça ;)
Par contre c'est vrai qu'avec des crampons c'est pas mal aussi mais on verra plus tard.
Titre: Re : Vos montures en photos
Posté par: julien le 09 novembre 2008 à 09:01:12
 ;)  nikel le supermot   :top: j'adore   vivement que j'ai le mien  :P
Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 09 novembre 2008 à 13:12:41
Félicitations pour la numéro 6 Cuarved !  :geek:

j'en connais à qui ça va donner envie ta nouvelle brêle , Ritchie ...
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 11 novembre 2008 à 21:04:18
Voila à quoi ressemble réellement ma moto  :D :P

( ( (

( ( (

( ( (

Photos prisent ce week end :)

Modèle 2003 (mars 2003)
16000 kms à ce jour, dont 5500 depuis que je l'ai (novembre 2007). A ce rythme là, elle aura 10 ans avant d'avoir 30000 bornes  :geek:
Très bonne moto, mais j'ai vraiment du mal à m'y faire sur les longs trajets (poignets... :dead:)
Titre: Re : Vos montures en photos
Posté par: Tonyo le 12 novembre 2008 à 10:21:16
C'est dingue comme ces R6 ressemblent à des 50... ou inversement...
En tout cas, c'est mieux qu'avec tes anciens carénages !!! :)
Titre: Re : Vos montures en photos
Posté par: FLO le 12 novembre 2008 à 11:46:38
C'est dingue comme ces R6 ressemblent à des 50... ou inversement...
En tout cas, c'est mieux qu'avec tes anciens carénages !!! :)

Oui mais avec ses anciens carénages il avait une R6 unique... :2funny:...c'est peu d'le dire.
Titre: Re : Vos montures en photos
Posté par: Sam le 12 novembre 2008 à 19:37:27
il est bien propre ce p'tit R6 !

Modèle 2003 (mars 2003)
16000 kms à ce jour, dont 5500 depuis que je l'ai (novembre 2007). A ce rythme là, elle aura 10 ans avant d'avoir 30000 bornes  :geek:
tu t'es relâché niveau moyenne kilométrique, nan ?

Très bonne moto, mais j'ai vraiment du mal à m'y faire sur les longs trajets (poignets... :dead:)
ceci explique cela ?

moi aussi j'ai la pire moyenne kilométrique avec le gex :( (2500km en 5 mois, le record étant 13000 en 6 mois avec le SS)
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 12 novembre 2008 à 19:43:16

moi aussi j'ai la pire moyenne kilométrique avec le gex :( (2500km en 5 mois, le record étant 13000 en 6 mois avec le SS)
Je te bats !!! 15.000 en 3 mois  :dead: :idiot: :2funny:
Titre: Re : Vos montures en photos
Posté par: Sam le 12 novembre 2008 à 19:49:39
lol toi t'es hors concours !!!

de toute façon je pensais pas avoir le record :P, juste un constat : pour toutes mes autres motos c'est du 12000 par an (je sais pas ce qui m'a pris avec la ducat lol)
pour contre avec le Gex c'est la loose : 2008 n'aurait pas été une année moto...

PS : 15000 en 3 mois  :o :o :o mais tu faisais des tours de pâté de maisons H24 ??? :D
Titre: Re : Vos montures en photos
Posté par: [email protected] le 13 novembre 2008 à 09:05:15
Voila mon GEX

( ( (

( ( (
Titre: Re : Vos montures en photos
Posté par: socata le 13 novembre 2008 à 09:49:35
Ralala je ne vous ais même pas présenter la mienne...

Alors une petite KTM 690 SM. Elle est dans le garage depuis avril 2008 et à grosso modo (pas d'insulte envers les modos  :o  ;D) 6000 kms au compteur.

J'en suis très très content, c'est mon premier mono après des 4 en lignes et des bi... je suis aux anges... C'est sur que sur un circuit de "vitesse" ça manque un poil d'allonge mais c'est un pied énorme tout de même.

Après, sur route, bien, très bien... Architecture moteur qui ne pousse pas à rouler vite en ligne droite. Vitesse de croisière comprise entre 110 et 120 km/h. Par contre en virage, bien emmené ça passe vite, très vite et bien.

Deux ombres au tableau: le prix de l'entretien pour qq qui roule un peu (rev. tout les 5000 km avec contrôle du jeux aux soupapes  :dead:) et la gourmandise de l'engin pour les pneus arrières (miam miam de la gomme tendre  :2funny:) faire 5000 km avec une enveloppe du type BT14/16 est un doux rêve, la moyenne doit être de 3500km. Pour la petite histoire, mon BT090 d'origine a fait 1800 km avec les 1000 km de rodage super tranquille  :o

Sinon, elle ne consomme vraiment pas beaucoup! Entre 4 et 6 litres/100  :top: et l'assurance n'est pas trop cher  >:D

Voila qq photos, ce fut pour moi aussi une année de peu de sortie moto mais j'ai fait de beaux voyages à son guidon:

( ( (

( ( (

( ( (

( ( (

 ( ( (

( ( (

( ( (

( ( (

( ( (

( ( (

Voila, cette présentation tardive me permet de vous mettre plein de photos  ;)

@ bientôt,
Titre: Re : Vos montures en photos
Posté par: FLO le 13 novembre 2008 à 12:04:32
J'en suis très très content

Au vu de ton exposé, tu as l'air satisfait de ta machine... :top:
Faudrait que j'essaye, la jambe sortie, ça me rappelle l'enduro... :'(
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 13 novembre 2008 à 12:05:45
Révision tous les 5.000 avec jeu aux soupapes  :dead: :dead: :dead: ça rebute un peu  ...
Moi qui rêve d'un LC4 2006  :'(
Titre: Re : Vos montures en photos
Posté par: socata le 13 novembre 2008 à 15:31:28
Révision tous les 5.000 avec jeu aux soupapes  :dead: :dead: :dead: ça rebute un peu  ...
Moi qui rêve d'un LC4 2006  :'(

Ouais... surtout durant la période de garantie... Ce n'est qu'une vérification du jeu aux soupapes, le mien n'a pas bronché d'un pouce... c'est KTM qui veut ça.

Concernant les 640 LC4 c'est encore pire l'entretien, mais il y a moyen de faire beaucoup soit même étant donné que - c'est une mono - que c'est accessible rapidement.

Titre: Re : Vos montures en photos
Posté par: Sylv1 le 16 novembre 2008 à 19:58:35
mon 6R, deja pret pour 2009

[img=]http:// ([img=] (


et avec son nouveau pot akra, elle fait un bruit de fou, ca manquait  :top:

EDIT: pourquoi mes photos s'affiche pas ,je fais tout comme d hab  :(
Titre: Re : Vos montures en photos
Posté par: nittaku le 16 novembre 2008 à 20:25:03
la voila syl1


Titre: Re : Vos montures en photos
Posté par: Silent Phong le 16 novembre 2008 à 20:29:42
Sylv1, chaque année, une peinture  ;D

jolie soit dit en passant ....
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 16 novembre 2008 à 20:30:59
cette fois j'arrete... ;D
Titre: Re : Vos montures en photos
Posté par: sphinx le 16 novembre 2008 à 20:32:55
superbe en effet  :)
Titre: Re : Vos montures en photos
Posté par: pop69 le 16 novembre 2008 à 20:41:31
@ sylv1:  Je voudrais juste savoir si la peinture sur les jantes si c'est de la peinture de carrossier normal ou une peinture ipoxi pour une meilleur tenu au eclat de gravier.
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 16 novembre 2008 à 21:08:19
peinture de carroserie normal.... et aucun soucis avec la tenue

la différence avec l'epoxy est la tenue dans la temps
15ans pour la premiere, 25 pour la seconde....y'a de quoi faire

Titre: Re : Vos montures en photos
Posté par: pop69 le 16 novembre 2008 à 21:20:01

la différence avec l'epoxy est la tenue dans la temps
15ans pour la premiere, 25 pour la seconde....y'a de quoi faire


c'est la seul différence??? 
je vais voir ça avec mon peintre adoré qui fait du super boulot :D [ mode leche c*l OFF] :geek:
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 17 novembre 2008 à 07:57:21
certains pourront te dire que l'epoxy resiste mieux aux impacts,

j'ai 2 couches de vernis sur les miennes et ca bouge pas, apres j'ai pas payé donc difficile d etre exigeant mais c superbe en tout cas

( et ca va que je suis maniaque sinon c vite sale  :idiot:)
Titre: Re : Vos montures en photos
Posté par: Tonyo le 17 novembre 2008 à 08:02:38
Merde mec, elle claque cette 6R...
J'vais garder ma mauvaise fois pour moi aujourd'hui !!!!

Jolie la moto  :top:
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 17 novembre 2008 à 08:24:33
merci ma couille !!! :top: :top:
Titre: Re : Vos montures en photos
Posté par: superkid le 17 novembre 2008 à 10:02:55
moi j'aime pas les motos bleues  ;D mais celle là elle est magnifique... :top:
Titre: Re : Vos montures en photos
Posté par: guillaume le 17 novembre 2008 à 10:30:46
Belle brêle Sylvain  :top: Dommage qu'on la voit pas assez pour nos balades "route"  ;)
NB: Cà doit être sympa le nettoyage de la jante arrière blanche
Titre: Re : Vos montures en photos
Posté par: Tonyo le 17 novembre 2008 à 11:04:57
Belle brêle Sylvain  :top: Dommage qu'on la voit pas assez pour nos balades "route"  ;)
NB: Cà doit être sympa le nettoyage de la jante arrière blanche

surtout quand tu sais que le phénomène graisse sa chaine juste avant ses balades !!!  ;) Enfin certains ne le font pas...
Titre: Re : Vos montures en photos
Posté par: Rems le 17 novembre 2008 à 11:37:50
NB: Cà doit être sympa le nettoyage de la jante arrière blanche

Pour avoir également des jantes de couleurs, j'peux te dire que c'est pas l'arrière la plus chiante à nettoyer, parce que la jante avant avec la taille des disques de freins :dead: et si en plus t'as pas de quoi lever l'avant pour faire tourner la roue librement (ou même la démonter)  :'(
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 17 novembre 2008 à 11:53:03
C'est juste un peu dommage que la TDF, le GB et la coque ne soient pas noirs non plus, t'aurais gagné quelques kilomètres/heure en bout de ligne droite  :geek: .... car c'est bien connu ..... les motos noires .....  :2funny:
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 17 novembre 2008 à 12:06:44
Belle brêle Sylvain  :top: Dommage qu'on la voit pas assez pour nos balades "route"  ;)
NB: Cà doit être sympa le nettoyage de la jante arrière blanche

vous vous trainez trop c pour ca  ;D ;D ;D :2funny: :2funny: :2funny: :2funny:

non c clair que j'ai ps bcp rouler cette année, entre mariage et l'achat de l'appart...mais vous me faites bien envie a voir vos CR... surtout votre bar et la copine de cardy, la serveuse  :2funny: :2funny: :2funny:

pour le nettoyage ca va bien, j'ai bequille avant arriere ... a coup de WD40 ca va nickel, l'avantage du blanc c que tu vois tout de suite ou c le rendu est immédiat...


d ailleurs autant si il fait beau le WE pro j'irai rouler, si ca tente qq
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 17 novembre 2008 à 14:11:16
Hum mais ce sont les trois griffes de Monster energy dans l'autre sens !

J'les aurais bien vu en vert :geek:

Joli en tous cas  :top:
Titre: Re : Vos montures en photos
Posté par: pop69 le 17 novembre 2008 à 17:28:00

vous vous trainez trop c pour ca  ;D ;D ;D :2funny: :2funny: :2funny: :2funny:

c'est pour ça que tu a les jantes blanche... c'est pour laisser une chance au copains :2funny:
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 17 novembre 2008 à 17:33:59

vous vous trainez trop c pour ca  ;D ;D ;D :2funny: :2funny: :2funny: :2funny:

c'est pour ça que tu a les jantes blanche... c'est pour laisser une chance au copains :2funny:

voila  >:D :idiot: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: pop69 le 17 novembre 2008 à 17:39:47
moi aussi je vais peindre mes jantes en blanche, mais pas pour laisser une chance au copains.... mais pour avoir une escuse ::) :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: EnMousse le 18 novembre 2008 à 16:20:41
certains pourront te dire que l'epoxy resiste mieux aux impacts,

j'ai 2 couches de vernis sur les miennes et ca bouge pas, apres j'ai pas payé donc difficile d etre exigeant mais c superbe en tout cas

( et ca va que je suis maniaque sinon c vite sale  :idiot:)

 Les peintures de carrosserie classiques tiennent aussi bien que de l'epoxy sur des jantes.
C'est pas tant la résistance dans le temps qui importe, c'est surtout leur resistance à l'usage. Les jantes sont assez mal-menées (pas autant que celle des voitures certes), et sont en sensibles aux impacts. Les machines à démonter les pneus sont sans pitié pour les bords de jantes, surtout si elles sont recouvertes de peinture de carrosserie. Ensuite tout dépend de la qualité donc de la délicatesse de la machine en question et aussi du monteur  ::). L'astuce serait de laisser la couleur d'origine (epoxy) sur les bords pour eviter les éclats de peinture, ou les polir mais là c'est une tout autre affaire  ;)

la différence avec l'epoxy est la tenue dans la temps
15ans pour la premiere, 25 pour la seconde....y'a de quoi faire


c'est la seul différence??? 
je vais voir ça avec mon peintre adoré qui fait du super boulot :D [ mode leche c*l OFF] :geek:

 Pas sure qu'il te garantisse la solidité d'une epoxy ton peintre adoré, mais tu peux toujours lui demander, ca te donnera l'occasion de le voir  :P ;D
 Tu peux aussi demander a celui qui a fait le noir matte des carénages de sylv1 mais il te donnera surement la meme version  ::) Et qui sait c'est peut être le même gars que ton peintre adoré  ;D
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 18 novembre 2008 à 16:45:21
Tu peux aussi demander a celui qui a fait le noir matte des carénages de sylv1 mais il te donnera surement la meme version  ::) Et qui sait c'est peut être le même gars que ton peintre adoré  ;D

coquinou va >:D :2funny: :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: pop69 le 18 novembre 2008 à 17:17:40
Tu peux aussi demander a celui qui a fait le noir matte des carénages de sylv1 mais il te donnera surement la meme version  ::) Et qui sait c'est peut être le même gars que ton peintre adoré  ;D

coquinou va >:D :2funny: :2funny: :2funny: :2funny:

je confirme :top: coquinou ;D ;D ;D
je te tiens au courant mon moumous  ;) ça fera encore une escuse pour une bouffe ::)
Titre: Re : Vos montures en photos
Posté par: EnMousse le 19 novembre 2008 à 17:42:56
Tu peux aussi demander a celui qui a fait le noir matte des carénages de sylv1 mais il te donnera surement la meme version  ::) Et qui sait c'est peut être le même gars que ton peintre adoré  ;D

coquinou va >:D :2funny: :2funny: :2funny: :2funny:

je confirme :top: coquinou ;D ;D ;D
je te tiens au courant mon moumous  ;) ça fera encore une escuse pour une bouffe ::)

Comment ça coquinou??  ::) C'est simplement de la mise en relation  :P Si je peux rendre service  ::) ;D
Titre: Re : Vos montures en photos
Posté par: Dispeed le 21 novembre 2008 à 19:50:58
ma moto n'est pas nouvelle mais j'ai fait le kéké avec ! Chacun son avis sur la personnalisation ;)

Le résultat de ma speed :
Posté le: 21 Novembre 2008 à 09:40:52
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 21 novembre 2008 à 19:53:43
.... et le pot ? c'est quoi de beau ? un Zard ? :love:
Titre: Re : Vos montures en photos
Posté par: FLO le 21 novembre 2008 à 21:57:52
Très très jolie  :love:, surtout la selle avec la bande dans la continuité des autres... :top:
Titre: Re : Vos montures en photos
Posté par: Ravage le 21 novembre 2008 à 22:11:53
je suis pas fan de triumph
mais la j adore
Titre: Re : Vos montures en photos
Posté par: Rocknroll le 22 novembre 2008 à 11:00:29
ma moto n'est pas nouvelle mais j'ai fait le kéké avec ! Chacun son avis sur la personnalisation ;)

Le résultat de ma speed :
Posté le: 21 Novembre 2008 à 09:40:52

En photo je la trouve pas terrible.

Mais j'ai eu la chance de la voir a dardilly.
Je m'en rappelle car c'est une magnifique réalisation surtout au niveau peinture.
Les accessoires anodisés je trouve sa fait un peu trop.

Je me trompe ou il y a bien des tribals dans la bande rouge si on regarde de près?
Titre: Re : Vos montures en photos
Posté par: FLO le 22 novembre 2008 à 11:02:44
C'est vrai que les embouts de guidon, les leviers et les cales pieds ça fait charger mais le reste est top... :top:
Titre: Re : Vos montures en photos
Posté par: guillaume le 22 novembre 2008 à 11:15:05
Une bande rouge a même été rajoutée sur le mur  :top:

 ;D ;D ;D

Nan en fait je suis pas fan de la personnalisation. Mais comme c'est subjectif hein.... En fait c'est tout le matos rouge avec la fourche dorée, je trouve que çà se marie pas trop. Y'a une couleur en trop.
Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 22 novembre 2008 à 14:01:14
Là c'est sur , y'en a pas deux comme ça. Joli.  :top:
Titre: Re : Vos montures en photos
Posté par: Dispeed le 26 novembre 2008 à 22:57:45
je vous remercie de vos avis.

C'est sur que le rouge/doré c'est dur à marier mais je joint l'utile (le maitre cylindre offre une puissance et une endurance bien supérieure à l'origine ! :top:) à l'agréable. Je voyait pas trop d'autre couleur avec le blanc... (Heureusement tu n'as pas vu les molettes de réglage de fourche qui sont bleu comme l'amortisseur :-\) mais je préfère le rouge :) )

Une bande rouge a même été rajoutée sur le mur
j'avais même pas fait gaffe ! ;D

Je me trompe ou il y a bien des tribals dans la bande rouge si on regarde de près?
non c'est pas du tribal (y'en a partout et je veux pas comme tout le monde.) mais c'est un effet craquelé effectivement. Elle est quelque fois visible à Dardilly (vu que j'y bosse)mais là 'fait froid ! :dead:

et le pot ? c'est quoi de beau ? un Zard?
Non un MIVV (c'est italien, pas cher et sympa à l'oeil mais la finition n'est bien sur pas à la hauteur d'un AKRA mais c'est pas le même prix ! :P)
Titre: Re : Vos montures en photos
Posté par: NeNe le 26 novembre 2008 à 23:01:25
Non un MIVV (c'est italien, pas cher et sympa à l'oeil mais la finition n'est bien sur pas à la hauteur d'un AKRA mais c'est pas le même prix ! :P)

Clair que c'est pas le même prrix, mais finalement le look est sympa, que ce soit le SUONO, le GP ou le X cone que j'ai sur la mienne
Titre: Re : Vos montures en photos
Posté par: Dispeed le 27 novembre 2008 à 01:13:23
a oui et c'est un modèle Suono ! j'ai oublié de préciser !  :idiot:
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 07 décembre 2008 à 15:46:40
Je ne boude pas mon plaisir de vous montrer ma brelle !

Buell S1 de 1998

- Peinture des tés, bas et pontets de fouche, en black.
- Ligne race complète poli
- Transmission over full US, 61x26 pignon allégé
- Carbu Mikuni HSR 42 + force winder
- Cable nology
- Disque avant "wave"
- Guidon + poignets Rizoma, black
- 95 bourrins à la roue  8)

Specials Thanks to Benjy, de si bien s'occuper de mon brellon, comme suis une pince en bricolage, bah Benjy il s'éclate !!!! Son boss aussi.... :roll:

A venir un jour, bras oscillant black et fourche all black.  :P
Et photos de la XB12STT spécial rallye  :idiot:







J adore la gamelle race poli  :afro:

Titre: Re : Vos montures en photos
Posté par: FLO le 07 décembre 2008 à 17:38:10
 :love: :love: :love:
Ça c'est une machine qui a 10 ans, et bien dit moi  :o elle est plus que propre...
Joli travail dessus... :top:
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 08 décembre 2008 à 09:32:05
:love: :love: :love:
Ça c'est une machine qui a 10 ans, et bien dit moi  :o elle est plus que propre...
Joli travail dessus... :top:

Et oui, merci  :-[ Je suis vaguement légèrement maniac avec mes meulles.... :idiot:
Titre: Re : Vos montures en photos
Posté par: Gouroups le 08 décembre 2008 à 09:46:30
Jolie machine, joli travail, propre, soigné, mais ...

Excuse mon ignorance en matière de Buell, mais il n'y a pas de radiateur sur ton bouzin ? Comment est refroidi le moulin ? ???

J'ai beau regardé toutes les photos en long, en large et en travers, je ne vois rien qui me fait penser à un refroidissement quelconque ?!?!? :-\

Sinon, joli coup, la plaque à l'horizontale anti-radar. :top: :2funny:
Titre: Re : Vos montures en photos
Posté par: Apeiron le 08 décembre 2008 à 10:12:19
Excuse mon ignorance en matière de Buell, mais il n'y a pas de radiateur sur ton bouzin ? Comment est refroidi le moulin ? ???

J'ai beau regardé toutes les photos en long, en large et en travers, je ne vois rien qui me fait penser à un refroidissement quelconque ?!?!? :-\

Moteur Harley Davidson, refroidissement air/huile! (comme les vieilles Monster 2 suppapes)
Avant que les japonais sachent se que c'est une moto, de l'autre coté de l'ocean il y avait les americains qui fabriquaient de vrais moteurs pour arracher le bitume  :top: pour l'epoque >:D
Le soucis c'est qu'il on gardé la technologie de l'epoque  :'(

Si non pour Dragonbuell: si tu trouve une occsa d'un S1 aussi bien que le tien, je suis acheteur :top:
Titre: Re : Vos montures en photos
Posté par: Dispeed le 08 décembre 2008 à 10:17:08
Excuse mon ignorance en matière de Buell, mais il n'y a pas de radiateur sur ton bouzin ? Comment est refroidi le moulin ? ???

J'ai beau regardé toutes les photos en long, en large et en travers, je ne vois rien qui me fait penser à un refroidissement quelconque ?!?!? :-\

Et ben oui le moteur à refroidissement à air ça existe encore et là y'a même pas de radiateur d'huile comme sur les anciens bandits ou monsters (encore actuels) ! ;D Un antique moteur HD.

En tout cas belle machine super bien entretenue !!! :top:
Titre: Re : Vos montures en photos
Posté par: sphinx le 08 décembre 2008 à 10:36:10
ma diversion de 92 n'avait aucun refroidissement non plus... comme quoi les japs savent aussi copier les amerloc...  >:D  ;D

superbe en tout cas cette buell  :top:
j'adore le pot en tout cas  >:D
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 08 décembre 2008 à 10:45:55
ma diversion de 92 n'avait aucun refroidissement non plus... comme quoi les japs savent aussi copier les amerloc...  >:D  ;D

superbe en tout cas cette buell  :top:
j'adore le pot en tout cas  >:D

Toi c'est différent, ta div' elle refroidissait l'huile en la diffusant dans l'air  :2funny:
Titre: Re : Vos montures en photos
Posté par: idltalk le 08 décembre 2008 à 10:48:15
Superbe cette bioul  :top:
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 08 décembre 2008 à 12:41:56
Thanks everybody, :coolsmiley: en effet point de refroidissement à part l'air ambiant... Mais on peut parfois poser un radiateur d'huile...

Pour ce qui est du support de plaque, bah c est simplement celui d'origine !  :top:

Quand à trouver des S1 dans le même état, c est pas simple et les prix flambes pour ce genre de meule...

Et il faut vraiment être un passionné voir un malade  :idiot:

Mais vos compliments me font très plaisirs et sachez qu'elle roule plutot bien...  :P
Titre: Re : Vos montures en photos
Posté par: mva38 le 08 décembre 2008 à 13:44:03
toujour aussi   belle ta  machine fred :top: :top: :top:

Titre: Re : Vos montures en photos
Posté par: le 20 décembre 2008 à 17:31:20
A mon tour  :D





Et j'ai commandé au pere noel un sabot moteur et un garde boue avant racing :top:
Titre: Re : Vos montures en photos
Posté par: pop69 le 17 janvier 2009 à 10:31:40
le gex près pour 2009 :top:

( (
Titre: Re : Vos montures en photos
Posté par: nonox le 24 janvier 2009 à 11:46:12
Titre: Re : Vos montures en photos
Posté par: blab le 24 janvier 2009 à 12:06:35
Un pot (de taille) normal  :D, ça fait du bien  :top:
Titre: Re : Vos montures en photos
Posté par: denver le 24 janvier 2009 à 16:08:58
+1 avec toi nox Gex powerrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr
Titre: Re : Vos montures en photos
Posté par: greg le 24 janvier 2009 à 17:08:45
le gex près pour 2009 :top:

( (

J'avais encore pas vu ça claque  :top:va falloir les nettoyer maintenant  ;D
Titre: Re : Vos montures en photos
Posté par: Ben le 27 janvier 2009 à 12:31:25
le gex près pour 2009 :top:

( (

J'avais encore pas vu ça claque  :top:va falloir les nettoyer maintenant  ;D

Va falloir LE nettoyer. T'écoutes pas les discussions au ninkasi!  :P :2funny:
Titre: Re : Vos montures en photos
Posté par: adrien le 04 février 2009 à 19:44:58


voici ma belle 750 gsxr de 89 avec moteur bandit 1200 preparé

arbre a came, doigt alumeur, boitier cdi, ligne vance hines,kit dyno pour le moteur

chassis fourche traditionel preparé ressort changé et huile, amorto ar ollins, bras ar de water maitre cylindre pr16

monocoque fait maison et obtique 200mm avec faisceau electrique simplifier, compteur mod7

voila voilou  ;)
Titre: Re : Vos montures en photos
Posté par: ritchie le 04 février 2009 à 19:47:13


voici ma belle 750 gsxr de 89 avec moteur bandit 1200 preparé

arbre a came, doigt alumeur, boitier cdi, ligne vance hines,kit dyno pour le moteur

chassis fourche traditionel preparé ressort changé et huile, amorto ar ollins, bras ar de water maitre cylindre pr16

monocoque fait maison et obtique 200mm avec faisceau electrique simplifier, compteur mod7

voila voilou  ;)
J'aime bien. Jolie :top:
Titre: Re : Vos montures en photos
Posté par: le 04 février 2009 à 20:16:10
Ca mériterai un petit saute vent et un sabot, mais c'est qu'un avis perso  ;)
Titre: Re : Vos montures en photos
Posté par: adrien le 04 février 2009 à 20:23:58
Ca mériterai un petit saute vent et un sabot, mais c'est qu'un avis perso  ;)

tu touches trop avec les sabots...

trop de tuning tue le tuning  :2funny:
Titre: Re : Vos montures en photos
Posté par: jmf69150 le 04 février 2009 à 22:32:45
  jolie machine et belle transfo, c'est toi l'origine de cette transfo ?
Titre: Re : Vos montures en photos
Posté par: adrien le 05 février 2009 à 09:28:25
  jolie machine et belle transfo, c'est toi l'origine de cette transfo ?

il y a juste les carenage qui etais comme ça quand je l'ai acheter apres j'ai tous fait 3 mois que je suis dessus elle est enfin fini.

Titre: Re : Vos montures en photos
Posté par: blab le 05 février 2009 à 11:21:20
voici ma belle 750 gsxr de 89 avec moteur bandit 1200 preparé

Et pourquoi le choix d'un 1200 bandit ?
Titre: Re : Vos montures en photos
Posté par: Ben le 05 février 2009 à 11:36:20
Y'a eu du boulot de fait dessus! Jolie!  :top:
Titre: Re : Vos montures en photos
Posté par: adrien le 05 février 2009 à 21:23:43
voici ma belle 750 gsxr de 89 avec moteur bandit 1200 preparé

Et pourquoi le choix d'un 1200 bandit ?

gros couple et sa marche casi aussi bien qu'un 11r dans les tour avec la prepas. De ttefaçon j'ai un moteur de 11r de 91 que je suis en train de refaire alors un jour peut etre il sera dedans ...
Titre: Re : Vos montures en photos
Posté par: Gianni le 15 février 2009 à 09:53:42
Ma cochone au Mont Verdun

( (

Posté le: 11 Février 2009 à 17:45:36
( (

Posté le: 13 Février 2009 à 14:19:12
( (
 Quand je vois mon pot, j'me dis vraiment que je fais de la peine :dead:
Titre: Re : Vos montures en photos
Posté par: adrien le 15 février 2009 à 10:52:35
question de gou, moi j'aime pas le pot haut et encors moin ceux sous la selle
Titre: Re : Vos montures en photos
Posté par: Gianni le 15 février 2009 à 12:09:31
Tu prefere peut être le style "vieille bécane". Mais c'est vrai que c'est question de goût personellement, son SV vaut 200 fois le mien, il est magnifique je trouve et le bruit du Devil...
Titre: Re : Vos montures en photos
Posté par: legone le 15 février 2009 à 23:40:55
Comme l'on dit certains trop de tunning tue le tunning.
Le mien de SV a encore son pot d'origine, il va avoir des liserets : c'est juste histoire de cacher le raccord de peinture de la jante que je trouve pas super mega top, et des belles grosses roulettes de protection.
Tout depend de l'esprit motard qu'on a, moi c'est pour faire des bornes, alors si je tombe j'ai pas envie de recommencer a être piéton comme aujourd'hui.

et ton SV tunning il roule bien? oui? c'est l'essentiel je trouve. ;) ;) ;)
Titre: Re : Vos montures en photos
Posté par: denver le 16 février 2009 à 00:00:49
( (
( (

Et voila mon gexou en moto d'honneur.....

en tout cas y'a pas a dire... les gexs en deco mariage, il pete la class....

Titre: Re : Vos montures en photos
Posté par: Warhead le 16 février 2009 à 10:13:09
mon bijou !

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 16 février 2009 à 11:18:22
Sans le saute vent, ça fait plus animal, j'aime bien  :top: ... et puis tu sens mieux les éléments quand tu roules  :2funny:
Titre: Re : Vos montures en photos
Posté par: Byronn le 16 février 2009 à 11:24:16
sauf si le trol est devant ... croyez moi, on vit ds le même appart et faut pas rester derrière ...
Titre: Re : Vos montures en photos
Posté par: mayrton le 16 février 2009 à 21:01:22
Zut j'ai oublié de prendre des photos avec ma nouvelle. Tout ce que je peu vous dire c'est que c'est une Motostandard.....powaaaa.
Elle était couleur rouille et depuis hier elle est devenue...ban ....

Titre: Re : Vos montures en photos
Posté par: LeZeBuDeSbOiS le 23 février 2009 à 23:12:56
Voilà ma Bête :


(ouai on fait avec les moyens du bord...)



correction liens images et nettoyage de 57 posts, 57 contre 2, belle perf' ::)
Titre: Re : Vos montures en photos
Posté par: Capelan30 le 25 février 2009 à 16:03:41
ça fait bizarre ses deux mini pots
Titre: Re : Vos montures en photos
Posté par: TroLiTo le 25 février 2009 à 16:20:08
ça fait bizarre ses deux mini pots

moi ca ma choque pas, j aime bien
Titre: Re : Vos montures en photos
Posté par: Mayerlink le 25 février 2009 à 18:07:30
Cette fois c'est la bonne ça devrait marcher voila donc mon maigre GSE bridé mdr mais je suis bien content de l'avoir, ça se pilote comme un vélo et pour un ptit jeune, c'est idéal  :geek:! Donnez votre avis ^^ et soyez pas trop vache lol Gazzz  8)
( (
Titre: Re : Vos montures en photos
Posté par: legone le 25 février 2009 à 18:20:52
avis: elle est propre comme moto (attention moto propre= moto qui roule pas :D)

avis N°2: tu vas vite t'en lasser :D
Titre: Re : Vos montures en photos
Posté par: ritchie le 25 février 2009 à 18:21:32
Je vais pas critiquer. ;)

J'avais la même jusqu'à il y'a pas longtemps. D'ailleurs je peux toujours la conduire tant que mon frère n'a pas le permis.
C'est vrai que pour commencer c'est un vrai vélo, dépasser par les concurentes en tenue de route mais pour se faire la main, ça va bien. :)
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 25 février 2009 à 18:23:18
halala une GSE de '92,  :love: montes y vite un amorto de Gex dessus, ce sera lejour et la nuit :2funny:

PS : elles etaient plus jolies en rouge cette année là ::)
Titre: Re : Vos montures en photos
Posté par: Mayerlink le 25 février 2009 à 18:49:15
Lol merci de vos avis ^^ et de vos conseils, là ça fait plus d'un an que je l'ai et javoue que un ptit gex ne ferai pas de mal, mais en attendant je suis content d'avoir ça c'est toujours mieux qu'un piti scooter mdr, mais j'ai pas tellement fait attention à la couleur quand je l'ai acheté c'était tellement un super coup que j'aurai meme pu l'acheter en rose bonbon  ;)
Titre: Re : Vos montures en photos
Posté par: Gouroups le 25 février 2009 à 20:53:10
avis: elle est propre comme moto (attention moto propre= moto qui roule pas :D)

Ou alors moto entretenue, bichonnée et bien lavée par son propriétaire. ::)

@Mayonnaise1 : Il ne te manquerait pas un embout de guidon ? (Accompagné d'une éraflure sur le réservoir et sur le carter. A moins que ce soit un reflet.)

@Mayonnaise2 : Pour la couleur, et bien, euuhhhh !!! Non j'dirai rien. ;) ;D

@Mayonnaise3 : Passer d'un GSE à un GEX c'est sûr que pour le coup tu vas sentir une différence.
Titre: Re : Vos montures en photos
Posté par: Mayerlink le 25 février 2009 à 22:48:03
avis: elle est propre comme moto (attention moto propre= moto qui roule pas :D)

Ou alors moto entretenue, bichonnée et bien lavée par son propriétaire. ::)

@Mayonnaise1 : Il ne te manquerait pas un embout de guidon ? (Accompagné d'une éraflure sur le réservoir et sur le carter. A moins que ce soit un reflet.)

@Mayonnaise2 : Pour la couleur, et bien, euuhhhh !!! Non j'dirai rien. ;) ;D

@Mayonnaise3 : Passer d'un GSE à un GEX c'est sûr que pour le coup tu vas sentir une différence.

Lol oui pour la couleur no comment rooo, mais la moto est souvent lavée et tres bien entrenue pourtant elle dors pas toujours sous un toit  :-\ mais enfin je la bichonne comme je bichonnerai UN GEX ptin !!! lol j'attendrai  ;)
Titre: Re : Vos montures en photos
Posté par: bro7 le 26 février 2009 à 07:20:38
( (
( (

Et voila mon gexou en moto d'honneur.....

en tout cas y'a pas a dire... les gexs en deco mariage, il pete la class....

 Salut Denver!
Tu ne travaillerais pas au Grand Lyon par hasard??
Une Gex toute décorée de frou-frou blanc, il me semble la voir régulièrement à l'Hotel!! ;)
Titre: Re : Vos montures en photos
Posté par: denver le 26 février 2009 à 11:28:11
( (
( (

Et voila mon gexou en moto d'honneur.....

en tout cas y'a pas a dire... les gexs en deco mariage, il pete la class....

Salut Denver!
Tu ne travaillerais pas au Grand Lyon par hasard??
Une Gex toute décorée de frou-frou blanc, il me semble la voir régulièrement à l'Hotel!! ;)

affirmatif mon petit !!!! je la met la haut quand j'ai reunion .... Grand lyon powerrrrr

 :2funny: :2funny: ca vas pas non!!!!!!
Titre: Re : Vos montures en photos
Posté par: bro7 le 03 mars 2009 à 17:19:20
Après le Bandit, voici une nouvelle bécane qui, pour l'instant, me donne que du plaisir!!
Et puis c'est terrible en tout terrain!!

Au lac de Miribel Jonage
( (,7b232870e6bb7a8676858d34052bb22e.jpg.html)

( (,afce0523f9a55d88f66bdcb2c2155a7d.jpg.html)

( (,c356ee01a16e985101ef4ebd298d6893.jpg.html)
Titre: Re : Vos montures en photos
Posté par: kokiu le 03 mars 2009 à 17:27:20
une tres bonne moto  :top:
que j'ai garder un semaine  :top: normal ces une HONDA
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 03 mars 2009 à 18:18:47
Elle a l'air en parfait état cette moto !  :top:
Titre: Re : Vos montures en photos
Posté par: adrien le 03 mars 2009 à 20:00:02
tu l'as acheter ou cet meule elle me dit quelque chose
Titre: Re : Vos montures en photos
Posté par: bro7 le 04 mars 2009 à 17:46:15
tu l'as acheter ou cet meule elle me dit quelque chose

 Tu vas peut-ètre pouvoir m'aider alors!!!!!
Je l'ai acheté à Motodepot rue de la part-dieu en début d'année.
Titre: Re : Vos montures en photos
Posté par: adrien le 05 mars 2009 à 13:01:49
tu l'as acheter ou cet meule elle me dit quelque chose

 Tu vas peut-ètre pouvoir m'aider alors!!!!!
Je l'ai acheté à Motodepot rue de la part-dieu en début d'année.

bein non sa doit pas etre la meme alors....
Titre: Re : Vos montures en photos
Posté par: kali le 08 mars 2009 à 00:06:15
Le 14 version K9 terminé  :) :


Titre: Re : Vos montures en photos
Posté par: Silent Phong le 08 mars 2009 à 00:14:21
C'est Kali qui a la plus grosse de LM  :2funny:
Titre: Re : Vos montures en photos
Posté par: kali le 08 mars 2009 à 00:20:31
C'est Kali qui a la plus grosse de LM  :2funny:

Tu plaisantes mais c'est ce que j'entends tous les jours à la maison !  :2funny:

ps : c'est pas bientôt fini de pourrir les posts !  >:( ;D
Titre: Re : Vos montures en photos
Posté par: Gianni le 08 mars 2009 à 00:28:16
Magnifique moto Kali! :top:
Titre: Re : Vos montures en photos
Posté par: lafraise le 19 mars 2009 à 16:04:45
salut a tous !!!

voila la mienne !!!!

 ;D ;D ;D ;D ;D ;D ;D ;D ;D
( (

Posté le: 19 Mars 2009 à 16:01:34
et voila mes pressedentes !!!!

ça ne rajeunit pas !!!! :( :( :( :( :(

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: legone le 19 mars 2009 à 16:05:17
depuis le temps que je voulais que la mienne figure ici

Titre: Re : Vos montures en photos
Posté par: lafraise le 19 mars 2009 à 16:08:22
il y a de jolies mobylettes ici !!!!

 :) :) :) :top: :top: :top:
Titre: Re : Vos montures en photos
Posté par: djou le 19 mars 2009 à 21:50:21
allé en tant que newbie je pense que je dois aussi passé par la.
une petite photo de mon 6r 636.

( (
( (

et une petite photo de mon hornet aussi. il est a vendre si vous êtes intéressé ou si vous avez des questions n'hésite pas a m envoyer des MP

( (
( (

Posté le: 19 Mars 2009 à 21:28:53
ca fait une heure que je me bats avec mes foto j arrive pas a les affichées pourtant je fait comme c expliqué dans le topic pour mettre les photos et rien  :'(

Edit Silent' = et hop là le liens photos qui vont bien  :D

Edit 2 = arf merde ! le sphinx m'a encore fait les freins!!! peutikon va!!!  >:(
Titre: Re : Vos montures en photos
Posté par: sphinx le 19 mars 2009 à 21:55:26
voila les photos  ;)


Titre: Re : Vos montures en photos
Posté par: djou le 19 mars 2009 à 21:58:48
heu la je comprend pas tout mais c'est bien mes foto lol pourrais je avoir une explication loooool :idiot:
Titre: Re : Vos montures en photos
Posté par: Dazou le 19 mars 2009 à 22:11:32
heu la je comprend pas tout mais c'est bien mes foto lol pourrais je avoir une explication loooool :idiot:

Je pense que vu que tu arrivais pas a mettre tes photos il les a mise a ta place.

Je mettrais d'autre photos de meilleurs qualité quand j'en aurais prise d'autre.

Voici les photos de la mienne (les mêmes que dans ma présentation) :



Titre: Re : Vos montures en photos
Posté par: djou le 19 mars 2009 à 22:18:14
sympa le Z
Titre: Re : Vos montures en photos
Posté par: legone le 19 mars 2009 à 22:35:50
non je pense qu'il a cite le post et qu'il a rajoute les balises qui vont bien. il y a un post sur l'ajout de photos sur le forum mais je ne sais plus ou.

voici deux autres photos:


Titre: Re : Vos montures en photos
Posté par: lafraise le 19 mars 2009 à 23:03:29
pour djou !!!

( (
Titre: Re : Vos montures en photos
Posté par: blab le 20 mars 2009 à 13:59:38
non je pense qu'il a cite le post et qu'il a rajoute les balises qui vont bien. il y a un post sur l'ajout de photos sur le forum mais je ne sais plus ou.

voici deux autres photos:


Sympa les photos sauf ... un petit détail ... la crotte sur le pneu avant !!! ça fait désordre  ;D
Titre: Re : Vos montures en photos
Posté par: Ben le 20 mars 2009 à 17:22:29
Sympa les photos sauf ... un petit détail ... la crotte sur le pneu avant !!! ça fait désordre  ;D

Y'en a qui peuvent parler...  ::)
On attend encore la photo de ta tondeuse sans le réservoir qui fait désordre... Et pas la peine de nous sortir le meilleur profil de miss CBR...

Titre: Re : Vos montures en photos
Posté par: labestiole le 20 mars 2009 à 18:12:48
C'est plus une moto, c'est de l'Art contempourien
( (
Titre: Re : Vos montures en photos
Posté par: ptiteguepe le 20 mars 2009 à 19:11:13
C'est plus une moto, c'est de l'Art contempourien

Art ContempLourien non plus

Tu exposes ds les environs ?!? Parce que.. je pourrais exposer avec toi ce qu'il me reste de ma BAR.. laquelle de jour en jour devient de plus en plus... abstraite ! A croire qu'ils y a 1 artiste ds ma rue  >:( très inspiré de ses précédentes créations qu'il modifie quasiment tous les jours...

Si on expose.. on pourrait peut-être s'refaire à lancer un nouvel Art.. !



Titre: Re : Vos montures en photos
Posté par: blab le 20 mars 2009 à 19:20:31
Y'en a qui peuvent parler...  ::)
On attend encore la photo de ta tondeuse sans le réservoir qui fait désordre... Et pas la peine de nous sortir le meilleur profil de miss CBR...


Oh le coup bas >:(
Bougre de Ducatiste vas  !  :dead:
Titre: Re : Vos montures en photos
Posté par: labestiole le 20 mars 2009 à 20:39:55
C'est plus une moto, c'est de l'Art contempourien

Art ContempLourien non plus
Tu exposes ds les environs ?!? Parce que.. je pourrais exposer avec toi ce qu'il me reste de ma BAR.. laquelle de jour en jour devient de plus en plus... abstraite ! A croire qu'ils y a 1 artiste ds ma rue  >:( très inspiré de ses précédentes créations qu'il modifie quasiment tous les jours...
Si on expose.. on pourrait peut-être s'refaire à lancer un nouvel Art.. !  


Plus possible, dans un grand élan de générosité j'ai fais don de son corps à la science  :'(
(sur les conseils de la mut')    ;)
Biz contempaporrien  :coolsmiley:

ps : elle est vivante peut être ta bar, elle va peut être muter ? !  :2funny:

Titre: Re : Vos montures en photos
Posté par: Ben le 20 mars 2009 à 21:43:08
Y'en a qui peuvent parler...  ::)
On attend encore la photo de ta tondeuse sans le réservoir qui fait désordre... Et pas la peine de nous sortir le meilleur profil de miss CBR...


Oh le coup bLAB >:(
Bougre de Ducatiste vas  !  :dead:

Pardon? ???
Je vois pas de quoi tu veux parler? ???


Titre: Re : Vos montures en photos
Posté par: iceman le 24 mars 2009 à 17:55:58
salut a tous  :top:
aller je vous met quelque petite photo de ma belle  ;)

( (

( (

( (

( (

a bientot  :top:
Titre: Re : Vos montures en photos
Posté par: Sylv1 le 24 mars 2009 à 17:57:22
putain elle claque sévère ta brêle...

j'adore ce CBR1000 :top:
Titre: Re : Vos montures en photos
Posté par: KmY le 24 mars 2009 à 18:06:21
putain elle claque sévère ta brêle...

j'adore ce CBR1000 :top:

meme si je suis moins fan de l'avant ...
cette impression qu'elle s'est payé un mur avec son nez ecrasé  ;D
mais très joli ce modèle
j'approuve  :D
Titre: Re : Vos montures en photos
Posté par: ptiteguepe le 24 mars 2009 à 18:47:51
putain elle claque sévère ta brêle...

j'adore ce CBR1000 :top:


En plus y'a pas à dire... le blanc c'est la claaassse quand même !!  ;)
Titre: Re : Vos montures en photos
Posté par: gregsp le 24 mars 2009 à 19:41:48
elle est tres belle ta cbr d'habitude suis pas fan de ce modele mais avec cette peinture :top:

tiens allé en meme temps une petite photos de la mienne qui vient d'etre finit

( (
Titre: Re : Vos montures en photos
Posté par: cymorill le 27 mars 2009 à 07:08:18
waou y a de sacré engins !

allez op je poste la mienne :

( (
Titre: Re : Vos montures en photos
Posté par: DIDIER30 le 27 mars 2009 à 15:46:49
my new bike

( (
Titre: Re : Vos montures en photos
Posté par: Ben le 27 mars 2009 à 17:47:57
Jolie italienne!  :top:
Titre: Re : Vos montures en photos
Posté par: flo 69 le 27 mars 2009 à 18:55:30
( (
( (

Ma bandit qui sort de chez PEARL MOTO a villeurbanne couleur d'origine .
Titre: Re : Vos montures en photos
Posté par: guillaume le 27 mars 2009 à 19:06:37
tu t'es fait avoir sur la taille de ta sacoche de réservoir  ;D
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 27 mars 2009 à 19:12:12
 :2funny: :2funny: :top:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 27 mars 2009 à 19:25:15
Guillaume, tékon, c'est qu'un bébé sacoche, elle va grandir  :2funny:
Titre: Re : Vos montures en photos
Posté par: Gianni le 27 mars 2009 à 19:33:56
 :2funny: :2funny:

Marrant, j'avoue  ;D C'est attendrissant  :D
Titre: Re : Vos montures en photos
Posté par: NeNe le 27 mars 2009 à 21:07:55
magnifique Flo !  ;) :top:
Titre: Re : Vos montures en photos
Posté par: ZedMed le 27 mars 2009 à 21:09:26
Oooh!! Il est balaize le saute vent... Harley styyyle...  ;D
Sinon belle peinture.  :top:
Titre: Re : Vos montures en photos
Posté par: Gouroups le 27 mars 2009 à 21:32:07
Guillaume, tékon, c'est qu'un bébé sacoche, elle va grandir  :2funny:

Ah bon ? :o C'est pas son sac à main ? >:D
Titre: Re : Vos montures en photos
Posté par: lafraise le 27 mars 2009 à 22:13:41
Guillaume, tékon, c'est qu'un bébé sacoche, elle va grandir  :2funny:

Ah bon ? :o C'est pas son sac à main ? >:D

ben non son sac a main il est rose !!!

pppfffftttttt   !!!!!
Titre: Re : Vos montures en photos
Posté par: thierry3769 le 28 mars 2009 à 00:09:59
Mon ami Pat sur le CBR.

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 28 mars 2009 à 10:23:02
Jolie combarde .... d'époque  :D
Titre: Re : Vos montures en photos
Posté par: flo 69 le 28 mars 2009 à 12:00:00
 Pour ma sacoche les gars ouai ces mon sac a mains je part pas sans mes tampons ;D
Titre: Re : Vos montures en photos
Posté par: thierry3769 le 28 mars 2009 à 13:42:05
Jolie combarde .... d'époque  :D

Mais heu, arrétez de vous moquer, ça date de 1997-1999.  :-[
A l'époque, c'était trés tendance !!

On n'avait pô beaucoup de sous à l'époque (et encore moins en fin de saisons), mais au moins c'était cool d'aller au Circuit du Val de Vienne, l'ambiance des stands (y avait aussi des pro qui tournaient), la douce sonorité des moulins traficottés...  :love:

Titre: Re : Vos montures en photos
Posté par: legone le 28 mars 2009 à 14:04:12
hehe le vignettage photo est d'epoque aussi :D

pour la crotte sur la mienne: qui dis usine desafectee, dis acces difficile: flaques d'eau et terre boueuse au pgm :D
Titre: Re : Vos montures en photos
Posté par: thierry3769 le 28 mars 2009 à 14:06:22
hehe le vignettage photo est d'epoque aussi :D

Bin ouais, photo d'époque passée au scan... désolé.  :-[
Titre: Re : Vos montures en photos
Posté par: Slyamigo le 28 mars 2009 à 20:10:14
Quelques photo de mon pti gex qui vient de rejoindre mon garage. Ca change du hornet, encore 1186km de rodage  :geek: Je craignais pour les tribals mais ça le fais bien  8)
( (,cfa1f6a6a578dfac069db2d09d6e1729.jpg.html)

( (,b2cbbc753cf885005d442e254a4f6d7e.jpg.html)

( (,a84b8db0e668874c162eef02c253f6e3.jpg.html)

( (,4d16bf7c387290837b77630b8894ddff.jpg.html)

( (,07a2e6ffa22732dd24d250218ac24e21.jpg.html)
Titre: Re : Vos montures en photos
Posté par: Ragedvaincre le 29 mars 2009 à 00:33:02
J'aime bien la première photo, en plus la moto est toute propre !
et la 4ème aussi avec le ciel qui se reflète avec le tribal à la suite : joli.

Félicitations  :top:
Titre: Re : Vos montures en photos
Posté par: Ben le 29 mars 2009 à 11:22:18
C'est raide de neuf! Avec ça tu va te faire plaisir!  :top:
Titre: Re : Vos montures en photos
Posté par: legone le 30 mars 2009 à 07:25:39
pourquoi ne pas avoir pris de photo en 3/4 arriere cote pot, connaissant le point de vue, ca aurait ete sympa d'avoir les gorges de l'ain en arriere plan en plus  ;) ;)
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 30 mars 2009 à 07:33:38
Ou que ça sent l'neuf !!
Très belle que dis-je !! Magnifique!!  :top:
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 30 mars 2009 à 12:55:32
pourquoi ne pas avoir pris de photo en 3/4 arriere cote pot, connaissant le point de vue, ca aurait ete sympa d'avoir les gorges de l'ain en arriere plan en plus  ;) ;)

Parceque le pot est moche ?  >:D

=>[]  :_cheesy:
Titre: Re : Vos montures en photos
Posté par: badgon3 le 07 avril 2009 à 20:17:21
( (
Titre: Re : Vos montures en photos
Posté par: nonox le 07 avril 2009 à 20:19:09
bien jolie monture que voila mais il y a un post pour poster nos belles :top:
Titre: Re : Vos montures en photos
Posté par: GAPS_38 le 07 avril 2009 à 20:23:13

en plus place bellecour  ;)
Titre: Re : Vos montures en photos
Posté par: bouledogue69 le 07 avril 2009 à 20:29:10
superbe photo  :top:
Titre: Re : Vos montures en photos
Posté par: badgon3 le 07 avril 2009 à 21:34:17

en plus place bellecour  ;)

j'ai profité de la manif de la ffmc pour faire la photo  >:D
Titre: Re : Vos montures en photos
Posté par: djou le 07 avril 2009 à 23:43:47
ha ba si c'était le jour de la manif soi t'es arrivé bon premier ( ce qui me semblerai bizarre avec un gex  :P) donc plus probable t'es parti bon dernier parce qui restait plus grand monde sur la place   :2funny:
Titre: Re : Vos montures en photos
Posté par: badgon3 le 08 avril 2009 à 09:29:57
ha ba si c'était le jour de la manif soi t'es arrivé bon premier ( ce qui me semblerai bizarre avec un gex  :P) donc plus probable t'es parti bon dernier parce qui restait plus grand monde sur la place   :2funny:

 :2funny: j'ai eu la chance de me metre quelque part ou il y avai personne ... pi je suis pas rester ... moi j'ai pas un gex de terrace a café ... on est parti dans le bugey juste apres avoir pri la photo
Titre: Re : Vos montures en photos
Posté par: GAPS_38 le 08 avril 2009 à 13:37:46
moi j'ai pas un gex de terrace a café

Titre: Re : Vos montures en photos
Posté par: suzukid77 le 09 avril 2009 à 21:08:02
Je me suis aperçu que je n'avais jamais complété ce post...donc j'y remédie   >:D:

Mon 1er BB  ;):

( (

Mon canarie  ;D:

( (

Ma folie (qui n'était pas pour moi)  8):

( (

La petite dernière, j'ai cédé à la tentation du 3 pattes  >:D  :coolsmiley::

( (

( (

Titre: Re : Vos montures en photos
Posté par: Aleph le 15 avril 2009 à 00:17:09
Bon bah que v'là les miennes :

Ma CBR 125 :

Avant :
Après :
Actuellement :

Mon actuelle Street Triple
Titre: Re : Vos montures en photos
Posté par: Guillaume_G le 27 avril 2009 à 21:30:22
Voici la mienne, une GSX650F de 2008 :




Titre: Re : Vos montures en photos
Posté par: djou le 19 mai 2009 à 22:44:44
nouvelle monture alors je suis obligé  ;D

( (
Titre: Re : Vos montures en photos
Posté par: Ptitfred le 25 mai 2009 à 17:39:55
histoire de faire comme beaucoup d'entre vous !!!

mon Ex :]] (

mon actuel :]] (

Titre: Re : Vos montures en photos
Posté par: Ptitducky le 25 mai 2009 à 17:49:00
C'est moi, ou il y a des entrées d'air de Renault Espace sur toutes tes coques arrieres... ::) ::) ::)

Ben c'est pas bô  :P ;D
Titre: Re : Vos montures en photos
Posté par: Ptitfred le 26 mai 2009 à 07:50:09
C'est moi, ou il y a des entrées d'air de Renault Espace sur toutes tes coques arrieres... ::) ::) ::)

Ben c'est pas bô  :P ;D

 ;D c'est toi car si tu regardes bien c'est le dosseret de selle qui as les grilles !!! (et je me suis dis la mm chose que toi c'est pour cela que je roule avec celui d'origine maintenant  :-\ )
Titre: Re : Vos montures en photos
Posté par: fredr6 le 26 mai 2009 à 22:09:14
A mon tour
Mes anciennes bécanes :
Alors tout d'abord ma première moto un FZS de 99 acheté en 2002
( (

Puis ensuite un FZ6N en 2005
( (

Puis un FZ1N en 2007
( (

Et depuis le mois d'aout 2008 en R6
( (
Titre: Re : Vos montures en photos
Posté par: Gianni le 26 mai 2009 à 22:17:12
T'aimes pas Yam c'est ça ?  ::) :dead:
Titre: Re : Vos montures en photos
Posté par: zekoala le 26 mai 2009 à 22:20:18
Mmmmm... fazer + leovince ! quelle douce mélodie!
je la regretterai presque cette fazer si décriée par tant de motards...
Titre: Re : Vos montures en photos
Posté par: fredr6 le 26 mai 2009 à 22:26:30
Mmmmm... fazer + leovince ! quelle douce mélodie!
je la regretterai presque cette fazer si décriée par tant de motards...
Une bonne bécane pourtant :top:
Titre: Re : Vos montures en photos
Posté par: airpébé le 07 juin 2009 à 19:30:25
apres le 1200 S
( (

une autre suz , le 1250 S abs

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: Francoistul le 15 juin 2009 à 15:22:54
Bonjour tous le monde!!!

Je suis un ptit nouveau du site!!! ;)

Je voulais quand même vous montrer ma ptite brêle en photos!! (600 Hornet)

Titre: Re : Vos montures en photos
Posté par: Ptitducky le 18 juin 2009 à 20:27:59
Euh...Néné...c'est quoi cet avatar... :D :D :D fait paytay les photos :D :D :D :D

PS : une fois de plus c'est une moto de fillette... :geek:
Titre: Re : Vos montures en photos
Posté par: NeNe le 18 juin 2009 à 20:56:51
Euh...Néné...c'est quoi cet avatar... :D :D :D fait paytay les photos :D :D :D :D

PS : une fois de plus c'est une moto de fillette... :geek:

 :2funny: :2funny:... ben oé une moto qui ne fais pas tache dans notre gay arsouille team  :P

tu as été sage une petite tof rien que pour toi  :geek:

Titre: Re : Vos montures en photos
Posté par: djou le 18 juin 2009 à 20:59:41
ca sent bon ca j aime bien  :top:  ;D
Titre: Re : Vos montures en photos
Posté par: legone le 18 juin 2009 à 21:06:56
pour l'avoir vue hier soir l'est joooooooooolyyyyyyyyy :D ca fait tres gay et la copine de ch1ldofmachin l'ayyyyymmmeee bbbbeaaaaaaaaaauuuuuuuuuccccccccuuuuuuuuu
Titre: Re : Vos montures en photos
Posté par: nonox le 19 juin 2009 à 18:47:24
Superbe mon NayNay :top: :top:
GEX POPOPOOOOOWAAAAAAAAAAaaaaaaaaaaaaaaaaaaaaa (et la tienne parait qu'elle fait de belles flammes >:D >:D)
Titre: Re : Vos montures en photos
Posté par: cricridelion le 19 juin 2009 à 19:41:52
Voila la mienne

Titre: Re : Vos montures en photos
Posté par: LeScribe le 22 juin 2009 à 12:08:14
Ben à mon tour ! Voilà la première Scribe-Bike :D Un modèle 2000 tout d'origine, tout simple, en super état, que plus super, c'est neuf !

Dans un avenir - proche ou pas - je pense simplement mettre un pot Leovince pour avoir une sonorité plus aguicheuse, puis éventuellement une selle moins glissante et un petit passage de roue pour le côté propreté.

Titre: Re : Vos montures en photos
Posté par: El Bourrito le 22 juin 2009 à 16:53:33
je n'ai pas encore posté ici ce qui chose faite maintenant
moto en mode grande balade et camping
Titre: Re : Vos montures en photos
Posté par: GAPS_38 le 25 juin 2009 à 23:44:24
J'ai enfin eu le permis ce matin, voici ma future:
le pot ixil syouplais!
Titre: Re : Vos montures en photos
Posté par: Geof le 19 juillet 2009 à 23:14:32
Voici ma petite dernière:

( (
( (

( (
( (
( (
Titre: Re : Vos montures en photos
Posté par: djou le 23 juillet 2009 à 22:00:52
elle a l air propre di donc
Titre: Re : Vos montures en photos
Posté par: NeNe le 23 juillet 2009 à 22:40:00

 :love: :love: :love:
Titre: Re : Vos montures en photos
Posté par: darky le 29 juillet 2009 à 11:34:43
Allez voici 2 3 photos de mon pti GEX aussi  8)



Titre: Re : Vos montures en photos
Posté par: badgon3 le 01 août 2009 à 16:17:01
voila les nouvelles couleur de mon gsxr 750 ...

Titre: Re : Vos montures en photos
Posté par: Ravage le 01 août 2009 à 21:30:12
elle pete en noir et jaune !!!!
Titre: Re : Vos montures en photos
Posté par: nonox le 01 août 2009 à 22:46:04
 :top: :top: :top:
GEX POWAAAAAAAAAAAAAAAAaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa :top:
et le noir et jaune sympa
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 01 août 2009 à 23:48:12
Ca claque ce fluo  8)
Titre: Re : Vos montures en photos
Posté par: Kyung le 01 août 2009 à 23:50:10
Ca claque ce fluo  8)

+1, Bien assortie au casque du coup >:D
Titre: Re : Vos montures en photos
Posté par: Francoistul le 03 août 2009 à 12:42:42
Ca claque ce noir et jaune!!! très jolie!! :top:
Ca va bien ensemble ses couleurs!! :top:
Titre: Re : Vos montures en photos
Posté par: legone le 03 août 2009 à 15:39:03
j'avais jamais remarque que la pompe a eau etait si exposee...

jolie coloris  ;) ;)
Titre: Re : Vos montures en photos
Posté par: V60 le 03 août 2009 à 15:39:05
ptite photo au retour d'une vadrouille en Ardèche  :top:
( (
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 04 août 2009 à 18:55:11
Toujours pas trouvé les rétro. de Gex !?
Quelques photos plus haut y'en a un sans rétro, peut être que !  :geek:
Titre: Re : Vos montures en photos
Posté par: badgon3 le 04 août 2009 à 19:17:47
Toujours pas trouvé les rétro. de Gex !?
Quelques photos plus haut y'en a un sans rétro, peut être que !  :geek:

j'ai un retro ... en embou de guidon  >:D
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 04 août 2009 à 19:19:55
J avais même pas fait attention.
Y'a V60 qui recherchais des rétro de GEX, enfin je sais pas si c'est toujours le cas !
Titre: Re : Vos montures en photos
Posté par: djou le 04 août 2009 à 21:45:07
bien sympa le jaune je pensais pas que ca rendrais si bien mais j aime bien
Titre: Re : Vos montures en photos
Posté par: badgon3 le 12 août 2009 à 16:10:35
Titre: Re : Vos montures en photos
Posté par: Gouroups le 12 août 2009 à 16:31:32
C'est bien, c'est assorti au jaune la poste du camion derrière.
Et c'est toi qui te charge des livraisons Colissimo en 48 h donc. :geek:
Titre: Re : Vos montures en photos
Posté par: badgon3 le 12 août 2009 à 16:36:34
C'est bien, c'est assorti au jaune la poste du camion derrière.
Et c'est toi qui te charge des livraisons Colissimo en 48 h donc. :geek:

avec un gex en 48h ... mouarf ca serai plutot 48 secondes  ;D
Titre: Re : Vos montures en photos
Posté par: idltalk le 12 août 2009 à 17:11:59
Chouette le gex fluo  :)
Titre: Re : Vos montures en photos
Posté par: cricridelion le 12 août 2009 à 18:49:22
J'adorre  :top: :top: :top:
Titre: Re : Vos montures en photos
Posté par: Gouroups le 12 août 2009 à 22:58:39
Mais les rétros (clignos) ? Ils sont où ? (non, pas là !!!)
Titre: Re : Vos montures en photos
Posté par: labestiole le 13 août 2009 à 00:19:38
Alors je ne résiste pas au plaisir et à la joie de vous présenter ma belle :  Une merveilleuse Suzuk 750 GSXF ne sais plus quelle année.  Sauf que depuis elle m'a quitté pour le paradis des motos. Je n'ai pas mise cette photo avant, car je viens de la recevoir pour mon anniversaire, avec cette belle histoire  :
Cette (très bonne) photo à été prise par hasard un soir de juin 2008 Par Flip69. Quelques jours plus tard un peu plus loin, toujours par hasard, il passait alors que je venais de me crasher. Il est resté jusqu'à ce que je sois évacué par les pompiers et s'est occupé de mon épave avec le dépanneur !  Un très grand merci à lui  :top:
Alors évidement la couleur et le reste ne sont plus aux goûts du jour, mais moi je la trouve toujours magnifique !!   
Allez ! la tof :
( (
Titre: Re : Vos montures en photos
Posté par: Gouroups le 16 août 2009 à 22:20:54
Allez, 2 p'tites tof de notre amie Ella, prises lors de la soirée d'anniversaire de Giapanini.


Et la version Pocket Bike de T'Gex.

Titre: Re : Vos montures en photos
Posté par: badgon3 le 16 août 2009 à 22:34:16
Mais les rétros (clignos) ? Ils sont où ? (non, pas là !!!)

Le retro il est en enbou de guidon ... et les cligno sont a la place des retroviseur d'origine ... tu voi les petites barettes noir ? ben c'est mes clignotant  :D

tres joli la photo vu de dessou  :top:
Titre: Re : Vos montures en photos
Posté par: blab le 17 août 2009 à 09:16:32
Le retro il est en enbou de guidon ... et les cligno sont a la place des retroviseur d'origine ... tu voi les petites barettes noir ? ben c'est mes clignotant  :D

Et ta plaque elle reflète les nuages ...

@Gouroupsoussous : c'est la moto qui est pocket ou le pile ôte qui est ... surdimensionné ?  :geek:
Titre: Re : Vos montures en photos
Posté par: Gouroups le 19 août 2009 à 13:29:54
@Gouroupsoussous : c'est la moto qui est pocket ou le pile ôte qui est ... surdimensionné ?  :geek:

T'as vu la baïte ? :2funny:
Titre: Re : Vos montures en photos
Posté par: Ravage le 08 septembre 2009 à 21:51:34


reste les accessoires a venir tel que : 
- passage de roue
- mini cligno avant
- tapis de reservoir bagster
- tampons de protection
Titre: Re : Vos montures en photos
Posté par: Shark le 08 septembre 2009 à 22:19:15
dis donc Ben, t'aurais pas changé de moto des fois ?  >:D
.........tu n'y échapperas pas à la rince mon garçon  ;) ;D
Titre: Re : Vos montures en photos
Posté par: Ravage le 08 septembre 2009 à 22:22:39
dis donc Ben, t'aurais pas changé de moto des fois ?  >:D
.........tu n'y échapperas pas à la rince mon garçon  ;) ;D

ton garcon c est leocc
et la rince, euh .....
Titre: Re : Vos montures en photos
Posté par: sncrx le 08 septembre 2009 à 23:34:11
bonsoir a tous voila j'ai l'honneur de vous presenter ma nouvelle... et oui je me suis separer du gs et adopter un bandit ... ( (

( (
Titre: Re : Vos montures en photos
Posté par: Ben le 10 septembre 2009 à 13:35:45
Super propre le SCANIA!  :top:

Jolie moto j'espère la voir bientôt en vrai! ;)
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 10 septembre 2009 à 20:52:57
DB S1, Red Racing Stripes BlingBlingMeuchine !

Elle est de fin 1998 et totalise 18000 km, je l'avais acheté à 10000. Elle marche du feu de dieu.

Merci à Benjy S.P pour sa patience, sa gentillesse et son professionnalisme. Sans oublier HD Lyon.

- Peinture des tés, bas et pontets de fouche, en black.
- Ligne race complète poli
- Transmission over full US, 61x26 pignon allégé
- HSR 42 + force winder
- Cable nology
- Disque avant "wave"
- Jantes PM
- Guidon + poignets Rizoma, black
- 95 bourrins à la roue  8)

A venir poulie Shark et Emc...

Le blème avec ces bécanes, tu sais quand tu commences mais tu sais jamais quand tu vas avoir fini.....  ;)  ;)  ;)  ;)   ;)   ;)


C'est chouette j en ai 2, une black une Red, Mais en réalité c est la même bécane, en noir c est l origine et j ai 2 carrosserie ;) ...


Titre: Re : Vos montures en photos
Posté par: jmf69150 le 10 septembre 2009 à 21:00:52
  euh si t'imes pa les Buell, on te donnera autre chose :2funny:
  jolie la rouge surtout elle est toute polie, il va falloir beaucoup mais beaucoup d'huile de coude apres chaque sortie
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 10 septembre 2009 à 21:07:41
  euh si t'imes pa les Buell, on te donnera autre chose :2funny:
  jolie la rouge surtout elle est toute polie, il va falloir beaucoup mais beaucoup d'huile de coude apres chaque sortie

Disons qu après plus de 20 piges en japonaise, j'ai découvert autre chose de plus, comment dire, disons de plus rustique   :top:
T inquietes pour le nettoyage quand tu le fais à chaque sortie,  ca prends pas plus de 15 mn, mais je reconnais que je roulerai pas avec tous les jours  :coolsmiley: Pour ca j ai mon vieux versity  :top:

La rouge et la noir c est la même, en noir c est la carrosserie d origine
Titre: Re : Vos montures en photos
Posté par: legone le 10 septembre 2009 à 21:23:07
elle est super jolie, j'adore. mais pourquoi lui avoir mis tant de "overmegamachinsdelamortquitue"?? elle n'allais pas bien avec "juste" une carrosserie et une ligne??
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 10 septembre 2009 à 21:35:17
Je pige pas bien mon lapin le "overmegamachinsdelamortquitue"  ::)
Si tu parles de la transmi courte, ? la moto est tout simplement plus agréable ainsi  :top:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 10 septembre 2009 à 21:36:00
Enorme la jante sur la photo de profil gauche  :o
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 10 septembre 2009 à 21:44:17
La classe :coolsmiley: par contre même ma GSE avait un bras oscillant plus gros... ;D

Sinon les passagers, les bagages, toussa quoi ? comment fais tu ? ???
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 10 septembre 2009 à 22:01:00
La classe :coolsmiley: par contre même ma GSE avait un bras oscillant plus gros... ;D

Sinon les passagers, les bagages, toussa quoi ? comment fais tu ? ???

Arffffffffff pour le bras oscillant certains disent que c est un bras de DTMX  ;D
Pour les passagers, bah c est non  ::) pour les bagages, sac à dos et grosse sacoche réservoir avec ventouse, ca tiens super bien  :top:

@silent, en effet quand tu l'as vu elle n avait pas ces jantes dites PM, (Performance Machine)

Le gros intérêt de cette moto c est son ses vibrations  :top: Enfin faut aimer  ::) Mais maître Cardoche avait trouvé qu'elle marchait bien  ;)

Franchement je pensais pas que ce genre de brelle aurait pu vous plaire.... :-\
Titre: Re : Vos montures en photos
Posté par: jmf69150 le 10 septembre 2009 à 22:08:06
  euh disons qu'on a pas l'habitude de voir de si belles preparation, vraiment JOLIE
Titre: Re : Vos montures en photos
Posté par: legone le 10 septembre 2009 à 22:30:58
non je parlais surtout de ca:

HSR 42 + force winder
- Cable nology

a vrai dire, j'ai pas compris ce que c'etait mais bon y en avais vraiment besoin??
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 10 septembre 2009 à 22:49:26
non je parlais surtout de ca:

HSR 42 + force winder
- Cable nology

a vrai dire, j'ai pas compris ce que c'etait mais bon y en avais vraiment besoin??

Oh yes ca aide bien pour choper les 95 poneys à la roue ar...
HSR42 c est un carbu mikuni qui remplace l original en 40
Force winder ! c est un filtre à air KN, pas le plus efficace, mais plutot pour le look
Cable nology, doivent améliorer l étincelle de la bougie, mais ca en revanche je pense que c est un bon placébo  :D
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 10 septembre 2009 à 23:05:32
mon voisin en a une équipée d'un sebring. Lorsqu'il démarre le matin, tout le quartier se réveille  :2funny:

pour l'avoir pilotée, c'est... disons... atypique.
Le chassis ultra court ne donne pas trop confiance lors des premières accélérations et la stabilité sur l'angle n'est bonne qu'à vitesse stabilisé. Si tu as le malheur de toucher les gaz... ça passe mais WOW, tu faits dans le caleçon  ;D. Un bon réglage des suspensions doit améliorer cet aspect.

par contre, c'est ultra agile et le couple permet de tirer une caravane dans le galibier :2funny:

C'est une moto fun mais avec laquelle je me suis fait peur malgré mes 12 années de pilotage quotidien  :-[.   
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 10 septembre 2009 à 23:22:57
Et encore tu parles des nouveaux modèles, la mienne est une vraie trapanelle coté chassis, mais le moteur c est un pur bonheur !!!  :top: Le vrai moulbiffe  HD mais retravaillé par Erik Buell un truc de  :2funny:
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 10 septembre 2009 à 23:32:52
Et encore tu parles des nouveaux modèles, la mienne est une vraie trapanelle coté chassis, mais le moteur c est un pur bonheur !!!  :top: Le vrai moulbiffe  HD mais retravaillé par Erik Buell un truc de  :2funny:

La sienne est effectivement une XB12R de 2006 :)
Titre: Re : Vos montures en photos
Posté par: Jazz le 11 septembre 2009 à 14:14:49
Moi, je la trouve absolument divine, surtout dans sarobe rouge diabolique  >:D
'Me plaîrait bien d'essayer un tréteau pareil.
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 11 septembre 2009 à 21:25:40
Et encore tu parles des nouveaux modèles, la mienne est une vraie trapanelle coté chassis, mais le moteur c est un pur bonheur !!!  :top: Le vrai moulbiffe  HD mais retravaillé par Erik Buell un truc de  :2funny:

La sienne est effectivement une XB12R de 2006 :)

Faut nous l envoyer au Crab ton pote !

Bon stop les compliments, elle va rougir  :2funny:
Titre: Re : Vos montures en photos
Posté par: TeddyBeer le 11 septembre 2009 à 22:19:42
Alors voilà j'ai vu que y'avait pas beaucoup de CB500 et du coup je viens en rajouter une autre huhu ...

Bon je pense refaire une peinture noire + orange, mais ca attendra encore un peut :p
Ah j'ai enlevé le gros autocollants numéro 4 sur la plaque phare, c'était trop moche ^^
Je vais garder le réservoir enfoncé, je trouve que ca la rend plus agressive, après chacun ses goûts. Pour le reste je vais pas trop y toucher, si juste changer la coque arrière avant de repeindre.

[img=] (

[img=] (

zut beau faire ce que je veux ca affiche pas correctement.  >:(

Titre: Re : Vos montures en photos
Posté par: dragonbuell le 11 septembre 2009 à 22:24:26
je peux hélas pas t aider  ;D
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 12 septembre 2009 à 00:46:26
Seul un Modo pourrait t'aider, il faut inscrire ton lien entre les deux balise [.img] et [/img], sans le petit point pour la premiere, le symbole de la petite photo.

Sinon ce CB gris me dis quelque chose surtout avec l'eternel et magnifique N°4.
A qui l'as-tu acheté ???

Si c'est le CayBay auquel je pense, tu roules sur une légende  ;)
Titre: Re : Vos montures en photos
Posté par: NeNe le 12 septembre 2009 à 01:46:36
Sinon ce CB gris me dis quelque chose surtout avec l'eternel et magnifique N°4.
A qui l'as-tu acheté ???

Si c'est le CayBay auquel je pense, tu roules sur une légende  ;)

Oé moi aussi.... Pis les bandes collantes ca me dis quelque chose aussi, même si elles n'étaient pas de la même couleur.....
Titre: Re : Vos montures en photos
Posté par: Gouroups le 12 septembre 2009 à 06:56:38
[img=]http:// (

[img=] (

zut beau faire ce que je veux ca affiche pas correctement.  >:(

Look Ze code I:

Look Ze code II :
Titre: Re : Vos montures en photos
Posté par: TeddyBeer le 12 septembre 2009 à 11:16:24
Bizarrement Gouroups j'utilisai les mêmes balises mais ça ne l'affichait paaaaaas ! sniff

Ouai donc pour les autres, le CayBay viens d'un pote, Dibale, et je ne sait pas si on devrais la considérer comme une légende (ce n'est pas Sheen non plus hein ^^), mais bon c'est vrai qu'il gère l'enflure :)
Maintenant il roule sur un Hornet de 2000 Bleu roi.
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 12 septembre 2009 à 15:20:50
Bon bah c'est bien ça !
On a dû se croiser !
Passe lui l'bonjour de NéNé et Zumi  :geek:
Titre: Re : Vos montures en photos
Posté par: TeddyBeer le 13 septembre 2009 à 13:37:57
J'y manquerais pas  :top:
Titre: Re : Vos montures en photos
Posté par: NeNe le 13 septembre 2009 à 16:46:26
Bizarrement Gouroups j'utilisai les mêmes balises mais ça ne l'affichait paaaaaas ! sniff

Ouai donc pour les autres, le CayBay viens d'un pote, Dibale, et je ne sait pas si on devrais la considérer comme une légende (ce n'est pas Sheen non plus hein ^^), mais bon c'est vrai qu'il gère l'enflure :)
Maintenant il roule sur un Hornet de 2000 Bleu roi.

Oé il gere pas mal le petit Seb ;), que ce soit sur piste... où en stunt  :top:

Ce n'est pas le même CB, mais la déco est reconnaissable, c'était le 19 mai 2006  ;)

Titre: Re : Vos montures en photos
Posté par: TeddyBeer le 13 septembre 2009 à 19:19:17
Oui, ils font de le Championnat de France 125CC maintenant, avec une CBR. Ils ont finit 3eme, pour une première année c'est plutôt excellent :)
Titre: Re : Vos montures en photos
Posté par: cologny le 04 octobre 2009 à 11:51:00

Titre: Re : Vos montures en photos
Posté par: Gouroups le 04 octobre 2009 à 11:55:00
Titre: Re : Vos montures en photos
Posté par: Ben le 04 octobre 2009 à 12:07:39
Les couleurs de fou!  :o  :top: J'dirais presque que le fazer est de trop sinon c'était parti pour le fond d'écran!  >:D :geek: :2funny:
Titre: Re : Vos montures en photos
Posté par: Aleph le 04 octobre 2009 à 15:57:42
Yes ! pour une fois qu'une Fazer est regardable  :top: >:D
Titre: Re : Vos montures en photos
Posté par: LeZeBuDeSbOiS le 14 octobre 2009 à 22:41:52
Mini photo pour une noiraude qui donne un max de plaisir  >:D

( (
Titre: Re : Vos montures en photos
Posté par: ducati666 le 17 octobre 2009 à 00:26:38
ma mienne
Titre: Re : Vos montures en photos
Posté par: tchoutch le 17 octobre 2009 à 10:27:06
ma mienne

Titre: Re : Vos montures en photos
Posté par: EnMousse le 17 octobre 2009 à 10:46:51
ma mienne


Superbe!  :top: Surtout la couleur, trés discrète  :2funny:
Titre: Re : Vos montures en photos
Posté par: emt069 le 18 octobre 2009 à 14:25:35
Merci pour l'accueil.
Voici ma belle... :love:
( (  ( (
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 21 octobre 2009 à 21:21:47
Mon "nouveau" destrier  :)




Titre: Re : Vos montures en photos
Posté par: Aleph le 21 octobre 2009 à 21:30:04
CB500  :top:

T'as déjà fait quelque chose sur les freins/suspensions ou elle est stock ?
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 21 octobre 2009 à 21:34:36
CB500  :top:

T'as déjà fait quelque chose sur les freins/suspensions ou elle est stock ?

Je viens à peine de l'acheter y'a 2h, donc j'ai encore rien fait la :D
En frein elle est stock, en suspension y'a des amortos hagon (équivalent origine, à peine mieux) quazi neufs, et de l'huile de fourche 15w.

Petit à petit elle finira surement équipée comme mon ancienne (durit avia, roulettes par carter, platines + pot réhaussés, pilot power etc).
Titre: Re : Vos montures en photos
Posté par: jeje69 le 21 octobre 2009 à 21:35:26
Retour au sources

J'vais facilement te pourrir maintenant  :dead: sauf au frein pi etre  :2funny:
Titre: Re : Vos montures en photos
Posté par: Aleph le 21 octobre 2009 à 21:37:56
Petit à petit elle finira surement équipée comme mon ancienne (durit avia, roulettes par carter, platines + pot réhaussés, pilot power etc).

Ca va watter  :love:
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 21 octobre 2009 à 21:43:12
Ca va watter  :love:
On verra  :)
Pour le moment c'est l'hiver qui approche, mode pépère et roulage économique.
On verra dans quelques temps comment j'me sens dessus et comment j'ai envie de rouler en 2010 :)
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 21 octobre 2009 à 21:43:49
T'as changer de garage aussi :D

Finit de galérer pour la garer dans le sous sol ;D
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 21 octobre 2009 à 21:58:42
T'as changer de garage aussi :D

Finit de galérer pour la garer dans le sous sol ;D
Ouais aussi  ;D

Maintenant c'est garage de luxe avec la place pour 2 voitures et 2 motos et encore de la place pour circuler autour de chaque  ;D
Titre: Re : Vos montures en photos
Posté par: jeje69 le 21 octobre 2009 à 22:00:23
J'en profite du coup

Après le Bourbonnais:  :'(


Pendant les réparations  :dead:



Qui à dit que c'était le bordel  >:D :2funny:

Le premier test sur la routes il y a de ca 2/3 semaines:



Le nouveau réservoir et coque arrière sont dans mon coffre prêt à  être peint, il me reste les autocollant à  trouver mais depuis que je sais qu'elle roule je suis moins pressé maintenant  ;D.

Je n'ai pas de photo de quand on a changé la fourche mais c'était joli  :2funny: montage à  la roots, avec un cric d'ax sous le carter et lestage de arrière avec tout ce qu'on à  trouver ( bidon d'huile, ancien pot d'échappement, liquide lave glace...) tout ca bien empiler  :2funny:

En tout cas ca fait plaisir d'avoir pu rerouler, mais pas au portefeuille  :dead:
Titre: Re : Vos montures en photos
Posté par: sphinx le 22 octobre 2009 à 00:25:11
 :2funny: :2funny: :2funny:

@ boby : joli le retour au source !  :top: reste plus qu'a retrouver ton âme de grand enfant...  :geek: ;D

@ jéjé : IMOTEP ! content que ca reroule droit  >:D parce que la derniere fois c'etait pas gagné  :geek: :dead: ;D
            mais elle est plus joli comme ca ! (enfin ca reste un VTR... :-X)

ps : les endivs ca cote encore en faite...  :dead: (
Titre: Re : Vos montures en photos
Posté par: toogazzz le 29 novembre 2009 à 23:50:11
Titre: Re : Vos montures en photos
Posté par: Goyakla le 30 novembre 2009 à 07:22:10
http://C:\Users\tititutu\Desktop\Mes documents\Mes images\MES MOTOS\red

Il faut héberger ta photo sur le web avant de pouvoir la mettre ici : ce n'est pas du téléchargement de photos vers LM, qui n'héberge pas ;)

Regarde ici ça peut t'aider : :)
Titre: Re : Vos montures en photos
Posté par: Nitro le 05 décembre 2009 à 18:38:03
A mon tour de vous présenter ma belle  ;D toute fraîche, j'ai même pas finit le rodage

 :coolsmiley: :coolsmiley:

c'est un vrai régal cette bécane  :top:
Titre: Re : Vos montures en photos
Posté par: Gianni le 06 décembre 2009 à 18:05:59
C'est officiel, la remplaçante  :top:

( (
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 06 décembre 2009 à 19:24:42
C'est violent l'image de 4.5Mo  :geek:
Titre: Re : Vos montures en photos
Posté par: jmf69150 le 07 décembre 2009 à 10:33:09
   C'est noel avant l'heure ! Veinard :top:
Titre: Re : Vos montures en photos
Posté par: nonox le 07 décembre 2009 à 11:00:15
Et ba je vois qu'on se fit zizir  :top:
Féloche et prend en soin ;)
Titre: Re : Vos montures en photos
Posté par: legone le 07 décembre 2009 à 11:08:50
c'est quoi ce vieux flare que tu y as rajoute ??  ;D tant que tu y etais, fallais changer le fond aussi :D
tres jolie moto  ;) :top:
Titre: Re : Vos montures en photos
Posté par: Gouroups le 08 décembre 2009 à 00:44:53
:top: Enjoyyyyyyyy !!!
Titre: Re : Vos montures en photos
Posté par: toogazzz le 09 décembre 2009 à 21:06:42
ma mémère de 81 000 km !!!!

[img=] (

Posté le: 09 Décembre 2009 à 21:05:28
Titre: Re : Vos montures en photos
Posté par: legone le 09 décembre 2009 à 21:20:22
ma mémère de 81 000 km !!!!

[img=]http:// (

Posté le: 09 Décembre 2009 à 21:05:28


titi, essais de citer mon message et tu comprendras  ;) ;)
Titre: Re : Vos montures en photos
Posté par: miloose69 le 14 janvier 2010 à 17:09:23
selle changée  :top:

( (

( (
Titre: Re : Vos montures en photos
Posté par: Gianni le 14 janvier 2010 à 19:10:31

Posté le: 14 Janvier 2010 à 19:09:35
Rien d'exceptionnel, la même Daytona que tous ceux qui l'ont en rouge  :dead: Mais je l'aime tellement  :love:

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: Slyamigo le 14 janvier 2010 à 19:33:26
ma mémère de 81 000 km !!!!

[img=]http:// (

Posté le: 09 Décembre 2009 à 21:05:28


titi, essais de citer mon message et tu comprendras  ;) ;)

81000Km et elle est toujours superbe  :top: :top: :top:
Titre: Re : Vos montures en photos
Posté par: vincrr le 14 janvier 2010 à 21:23:27
Ouai elle est vraiment superbe!!! :top: :top:
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 14 janvier 2010 à 22:14:27
Ahhhh, la 9-54  :love:... CBR préférée après l'originale (92-93  >:D).

Celle-ci est dans un état incroyable au regard de son kilométrage, mais c'est bien connu, honda c'est du solide  :top:

D'autres photos de l'engin  ???
Titre: Re : Vos montures en photos
Posté par: miloose69 le 15 janvier 2010 à 08:58:33

Posté le: 14 Janvier 2010 à 19:09:35
Rien d'exceptionnel, la même Daytona que tous ceux qui l'ont en rouge  :dead: Mais je l'aime tellement  :love:

c'est bo une dayto  :love: :love:  :top:
Titre: Re : Vos montures en photos
Posté par: vincrr le 15 janvier 2010 à 09:48:29
Voila ma "pitite" becane a moi,en vente... :-\
Titre: Re : Vos montures en photos
Posté par: cricridelion le 15 janvier 2010 à 09:59:50

Posté le: 14 Janvier 2010 à 19:09:35
Rien d'exceptionnel, la même Daytona que tous ceux qui l'ont en rouge  :dead: Mais je l'aime tellement  :love:

c'est bo une dayto  :love: :love:  :top:

+10000 c'est sur qu'elle est magnifique cette moto bon choix et felicitations
Titre: Re : Vos montures en photos
Posté par: legone le 15 janvier 2010 à 10:32:20
hhhhheeeeeeuuuuu elle est impeccable parce que le proprietaire en prends soin, mais aussi parce qu'il est mecano moto et que suite a son accident il vient de la remettre a neuf  ;) ;)
Titre: Re : Vos montures en photos
Posté par: kos le 22 mars 2010 à 19:57:56
voici ma ptite mob
Titre: Re : Vos montures en photos
Posté par: tchoutch le 22 mars 2010 à 20:17:20
voici ma ptite mob

 :idiot: :idiot: :idiot: :idiot: :idiot: :idiot: :idiot: :idiot: :idiot: :idiot:
Titre: Re : Vos montures en photos
Posté par: bandit69 le 28 mars 2010 à 11:49:59
650 k7 désole je n'arrive pas a mettre de photo
Titre: Re : Vos montures en photos
Posté par: airpébé le 28 mars 2010 à 12:13:55
pour les photos voir ci dessous
Titre: Re : Vos montures en photos
Posté par: fabien996 le 13 avril 2010 à 10:31:59
Voila la mienne,quelque uns l'ont déja vu en vrai,TRIUMPH SPEED TRIPLE 955I de 2002,34000km!!  :love:


Titre: Re : Vos montures en photos
Posté par: 23 le 13 avril 2010 à 10:57:25
voici ma mienne: YZF R6 modèle 2000:
( (

( (
Titre: Re : Vos montures en photos
Posté par: Fifix le 22 avril 2010 à 16:03:47
Faudrait que je fasse gaffe, à force de mater ta R6, j'ai foutu plein de bave sur mon clavier....  :top:
Titre: Re : Vos montures en photos
Posté par: 23 le 25 avril 2010 à 12:09:45
Merci Fifix ;)
Titre: Re : Vos montures en photos
Posté par: fabien996 le 25 avril 2010 à 13:14:52
Pour l'avoir vu hier,c'est impréssionnant de voir dans l'état ou il est..... :o :top:
Titre: Re : Vos montures en photos
Posté par: Platon le 06 mai 2010 à 14:05:47
Voici mon 929 CBR de 2000 totalisant 31000Km.
Je l'ai depuis septembre 2009.

( (

Uploaded with (
Titre: Re : Vos montures en photos
Posté par: legone le 06 mai 2010 à 14:22:46
HHHHHHHHAAAANNNNNNN CHOUPIPACHUPS!!!!!! y en a un autre il a pique ta tomo!!!!!!!!! ;D ;D
Titre: Re : Vos montures en photos
Posté par: fredingue le 06 mai 2010 à 14:24:24
CHOUPI J'ai trouvé des pieces :2funny: :2funny: :2funny: :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: didlawowo le 06 mai 2010 à 14:27:34
faut m'expliquer ce que font les mecs pour avoir des breles de 10 ans avec 30 000 bornes quoi, ils osent pas les usés ? les miennes se bouffent 10 000 par an et je force pas.
Titre: Re : Vos montures en photos
Posté par: fredingue le 06 mai 2010 à 14:32:09
Ben il est juste en dessous de la moyenne nationale...
Titre: Re : Vos montures en photos
Posté par: legone le 06 mai 2010 à 14:50:47
il roule juste comme il l'entends surtout....
Titre: Re : Vos montures en photos
Posté par: fredingue le 06 mai 2010 à 15:49:36
Chacun voit midi à sa porte  ;)
Titre: Re : Vos montures en photos
Posté par: 23 le 06 mai 2010 à 16:05:02
faut m'expliquer ce que font les mecs pour avoir des breles de 10 ans avec 30 000 bornes quoi, ils osent pas les usés ? les miennes se bouffent 10 000 par an et je force pas.

Apparement, tu n'es pas marié,tu n'as pas d'enfants, donc tu peux rouler quand bon te semble. C'était mon cas avant et maintenant que j'ai la maison, la femme, les enfants il faut faire des concessions et je ne peux plus être tous le temps le cul  vissé sur la brèle. C'est le cas de beaucoup de motards, je pense.
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 06 mai 2010 à 16:08:45
Ou être un vrai passionné et prendre ta moto tous les jours pour aller au Taf !!

Enfin j'dis ça , j'dis rien  :geek:
Titre: Re : Vos montures en photos
Posté par: 23 le 06 mai 2010 à 16:09:35
J'habite à 300 metre du taf et quand j'habitait Vienne et que je travaillait déjà ici je n'avais que la moto, ça m'est arrivé de faire les 70 bornes sous la neige, alors pour la passion je crois que je l'ai.
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 06 mai 2010 à 16:11:18
Bah un 300 m, départ arrêté  ;D
Titre: Re : Vos montures en photos
Posté par: 23 le 06 mai 2010 à 16:14:09
Alors à ce moment là je redescends de 100 metres et comme ça je me fait un 400 départ arrèté ;D
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 06 mai 2010 à 16:19:19
Ouah le plus chiant c'est d'installer les cellules chrono.
Je ne remets pas en doute ta passion pour la moto.
C'est sûr qu'en ayant des gones ça doit plus être évident.
Pour l'instant j'en ai pas, j'm'entraine  :dead:

On va arrêter de pourrir le post des photos, les modos sont nous taper sur les doigts.
Titre: Re : Vos montures en photos
Posté par: fredingue le 06 mai 2010 à 16:23:59
J'habite à 300 metre du taf et quand j'habitait Vienne et que je travaillait déjà ici je n'avais que la moto, ça m'est arrivé de faire les 70 bornes sous la neige, alors pour la passion je crois que je l'ai.
Je confirme. 22Mkms en 10 mois, avec 1 R6, sur tous les types routes :top: :top: :top: :top: :top: :top:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 06 mai 2010 à 16:36:29
Et puis y'en a qui ne font pas que de la moto... :idiot:
Titre: Re : Vos montures en photos
Posté par: cuarved le 06 mai 2010 à 16:41:39
Et puis y'en a qui ne font pas que de la moto... :idiot:

Et puis y'en a qui n'en ont pas forcément les moyens...
Ce n'est pas parce que tu en as envie que tu as l'argent pour le faire...
Pour moi, la passion ne se résume pas au nombre de kilomètres que tu fais... mais plutôt au(x) sacrifice(s) que tu fais pour pouvoir les faire...
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 06 mai 2010 à 17:39:34
Je suis tout à fait d'accord !
J'aurais plus de thune j'aurai acheté un Porsche Cayenne au lieu d'une autre moto pour aller au boulot.

Perso je suis un petit rouleur avec un niveau de pilotage plus que bas.
J'ai des leçons à donner à personne en ce qui concerne la moto.
Je me suis sans doute mal exprimé.
Je n'aime pas les généralités en plus.
Titre: Re : Vos montures en photos
Posté par: 23 le 06 mai 2010 à 17:45:49
Aucun problème ZUM, perso je répondais surtout à didla qui demande des explications :top:
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 06 mai 2010 à 17:53:14
Ouf car moi niveau kilométrage  :2funny:
Mes motos j'lé ai pas usées.
J'en ai même honte.
Heureusement que je me rattrape depuis.

J'voulais simplement dire que le gars qui roule tous les jours est un passionné ! Forcément il a pas le choix  :P
Titre: Re : Vos montures en photos
Posté par: doups le 06 mai 2010 à 17:56:16
didl il est jeune, il comprendra qd il aura vieillit ;)

Titre: Re : Vos montures en photos
Posté par: NeNe le 06 mai 2010 à 20:38:14
 :gourdin: :gourdin: :gourdin: :gourdin:

hop hop hop on arrête de pourrir s'il vous plait  ;)
Titre: Re : Vos montures en photos
Posté par: Goyakla le 07 mai 2010 à 07:53:29
J'voulais simplement dire que le gars qui roule tous les jours est un passionné ! Forcément il a pas le choix  :P

J'ai quand même l'impression qu'on mélange les idées d'utilitaire et de passion... Bien que ça puisse se retrouver chez certaines personnes, je ne pense pas qu'on puisse généraliser ???
Titre: Re : Vos montures en photos
Posté par: CHUPACHUPS le 07 mai 2010 à 08:33:32
Voici mon 929 CBR de 2000 totalisant 31000Km.
Je l'ai depuis septembre 2009.

( (

Uploaded with (

 :top: :top: :top: :top: :top: elle cros belle cette bécane....

punaise ouep si j'avais su me serais pas casé la tête à chercher des pièces ...

 :2funny: :2funny: :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: X-Off le 17 mai 2010 à 20:20:42
Je reviens enfin, après des années passées à errer dans l'inconnu à la recherche d'une monture pour moi!!!

Et je l'ai trouvée, Ma S2R DARK!!!  >:D >:D >:D >:D

Posté le: 17 Mai 2010 à 19:46:08
Avec la photo c'est mieux!!!!  :D

Titre: Re : Vos montures en photos
Posté par: lionelpylot le 17 mai 2010 à 20:26:50

Allez je me lance depuis le temps, quelques photos prises cet après midi après un bon lavage !!!

( (

( (

( (

( (

( (

( (

( (

( (

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 17 mai 2010 à 20:37:23
Tres jolie moto  :top: mais je ne te donne pas 1 mois sans te prendre une prune pour ta plaque.... ::)
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 17 mai 2010 à 20:39:17
Tres belle !!

Mdr le petit détail qui tue !!!  :2funny: :2funny:

Ca peut marcher lors d'un controle  :geek:
Titre: Re : Vos montures en photos
Posté par: Grand Rémy le 17 mai 2010 à 20:39:58
pfiouuu bel engin !!
j'oserais mème pas la garée dans la rue sans finir complètement parano, déja qu'avec mon Super Té je le suis !
Titre: Re : Vos montures en photos
Posté par: lionelpylot le 17 mai 2010 à 20:46:12
Tres belle !!

Mdr le petit détail qui tue !!!  :2funny: :2funny:

Ca peut marcher lors d'un controle  :geek:

LOL on verra si ca aide!

La plaque est homologuée et l'inclinaison réglable..

Titre: Re : Vos montures en photos
Posté par: brubz le 17 mai 2010 à 21:25:26
Je reviens enfin, après des années passées à errer dans l'inconnu à la recherche d'une monture pour moi!!!

Et je l'ai trouvée, Ma S2R DARK!!!  >:D >:D >:D >:D

Posté le: 17 Mai 2010 à 19:46:08
Avec la photo c'est mieux!!!!  :D

joli tracteur... ;-)
Titre: Re : Vos montures en photos
Posté par: X-Off le 17 mai 2010 à 21:43:12
ça avance plutot pas mal pour un tracteur!!!!!  :top:
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 17 mai 2010 à 23:57:07
Tres belle !!

Mdr le petit détail qui tue !!!  :2funny: :2funny:

Ca peut marcher lors d'un controle  :geek:

LOL on verra si ca aide!

La plaque est homologuée et l'inclinaison réglable..

C'est pas de la plaque que je parle moi  :geek:
Titre: Re : Vos montures en photos
Posté par: ninja6 le 18 mai 2010 à 01:11:43
le porte clé ?
Titre: Re : Vos montures en photos
Posté par: ZUM69 le 18 mai 2010 à 01:29:01
Titre: Re : Vos montures en photos
Posté par: zigzigeur le 29 mai 2010 à 08:12:21
et voici la mienne acheté tel quel :

Je suis revenu à mes premiers amours le bi ... j'en cherchais une pas trop chère (1000 € ca va) car rénovation de la maison et projet de second bébé donc il a fallu minimiser le poste de dépense moto. Je tiens à remercier les bouchons lyonnais qui ont permis d'étayer ma thèse vis à vis de ma chère et tendre que la moto était un élément indispensable ! enfin elle sera aussi à mes cotés lors des balades car elle aime la moto ::)

svs de 99 avec 83°°° km
prévu ponçage des carénages suivi d'une peinture pour plus tard...
Démontage de tout ce que je me sens capable de démonter et remonter surtout.
Vidange de tous les fluides ce week end
Ca va pouvoir commencer à rouler d'ici quelques jours... enfin!

j'ai pas refait de photo ce sont les photos du vendeur vous la verrez bientot lors d'une balade
( (

( (

( (

ouah coment j'ai eu du mal à mettre les photos ;D

et aussi de la yam qui honore mon garage un 400 wrf de 98 avec un bon vieux kick ca monte aux arbres un engin pareil:
( (

( (

et que je monte de temps en temps en supermot !
Titre: Re : Vos montures en photos
Posté par: zOU le 05 juin 2010 à 12:04:01
Les monstres:

GSE500 vendue et regrettée, surtout avec le silencieux Laser...

La Tenere lors de notre periple de Juin 2009 (,+France&daddr=Le+Mans,+France+to:St-Etienne,+France+to:Oyonnax,+France+to:Aix-les-Bains,+France+to:44.559163,6.080933+to:Grasse,+France+to:Vintimille+Italie+to:Genova+Italy+to:Pisa+Italy+to:Firenze,+Italy+to:Venice+Italy+to:Aosta,+Italy+to:Oyonnax,+France+to:D2076+to:Bourges,+France+to:Saumur,+France+to:Avenue+Georges+Pompidou%2FN162+to:Roscoff,+France&hl=en&geocode=FQaD5wIdsizD_ylnXK1-ReETSDFFSFvQ-e_afg%3BFSSK3AIdswcDACkxqvMU0ojiRzF_4H1qTF0CaQ%3BFZVatQId9_NCACkV5M8N_6v1RzFWV2OH27IxBg%3BFVPVwQIdHk1WACnP8FwheL2MRzGwCMLkKqsIBA%3BFZoquQIdBURaACnT0rmdoqCLRzFAubrkKqsIBA%3B%3BFTstmgIdG6VpACn77Vg5_iXMEjEtLviMmCd3EQ%3BFVEwnAIdYxN0ACk5f7Fz4OzNEjEgzjxHfeYFBA%3BFRaZpQIdZVKIAClpb64h5kPTEjG7Arq1xlP3aQ%3BFScOmwIdqKOeACn9PAnRnpHVEjEMRBgkvvpkTA%3BFZzbmwIdRcSrACnfTKTToFYqEzHZl2CJaKVFug%3BFeBFtQIdYEa8ACkfb1JTCq9-RzGwX5EVhwkHBA%3BFVjcuQIdUpdvACkbrs2ItyCJRzERoRYJWMpejQ%3BFVPVwQIdHk1WACnP8FwheL2MRzGwCMLkKqsIBA%3BFbKKygIdeoAtAA%3BFYxtzgIdo5EkACkXtJu4d5b6RzG-hVzNLCj7yw%3BFfwP0QIdI7r-_ykJvJujzfAHSDEAiQ0eUjcNBA%3BFfC62QId0kf1_w%3BFQaD5wIdsizD_ylnXK1-ReETSDFFSFvQ-e_afg&mra=dpe&mrcr=4&mrsp=5&sz=8&via=5,14,17&sll=44.894796,5.284424&sspn=2.591657,4.938354&ie=UTF8&ll=45.39845,4.998779&spn=5.137767,9.876709&t=h&z=7)

Ma VFR en mars 2007, lors de mon voyage Jura -> Irlande

Le mois dernier, il en manque un bout non ?  :idiot: :2funny:
Titre: Re : Vos montures en photos
Posté par: Grand Rémy le 11 juin 2010 à 12:11:01
pitain j'y arrive vraiment pas avec le phare de cette ténéré !
tout est joli sauf ça !
Titre: Re : Vos montures en photos
Posté par: zOU le 11 juin 2010 à 12:17:09
pitain j'y arrive vraiment pas avec le phare de cette ténéré !
tout est joli sauf ça !
boo !
Titre: Re : Vos montures en photos
Posté par: zack le 06 juillet 2010 à 22:15:38
Comme je suis nouveau, je vous met des  photos de mon brélon.

c'est une DUCATI 888 de 1994, qui a maintenant dépassé les 65 000 kms. Comme quoi c'est fiable une Ducat ;D




A bientôt sur nos routes. zack ;)  

Titre: Re : Vos montures en photos
Posté par: Silent Phong le 06 juillet 2010 à 22:29:50
Belle machine, j'aime bien   :top:
Titre: Re : Vos montures en photos
Posté par: zack le 06 juillet 2010 à 22:35:48
Merci. Je suppose que c'est toi qui m'a redirigé dans la bonne section ;)
Titre: Re : Vos montures en photos
Posté par: Ben le 08 juillet 2010 à 14:02:50
Très joli ton 888 il fait pas ses bornes!!!  :top: :top: :top:
Titre: Re : Vos montures en photos
Posté par: zack le 08 juillet 2010 à 17:19:33
Faut en prendre soin des mamies ;)
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 12 juillet 2010 à 01:10:12
ne pas confondre endurant et fiable  >:D

Par contre excellente partie cycle, parait-il  :)
Titre: Re : Vos montures en photos
Posté par: zack le 12 juillet 2010 à 16:20:24
C'est un rail, par contre c'est un vrai camion a conduire. :-\ C'est hyper physique, il faut sans cesse sortir le cul pour tourner. Après une bonne arsouille t'est lessivé. mais dieu que c'est bon, quand t'as trouvé le mode d'emploi. :top:
Titre: Re : Vos montures en photos
Posté par: 23 le 12 juillet 2010 à 20:19:14
Elles sont belles les anciennes Ducat' :top:

Féloches pour le grand soin que tu apportes à ton destrier :top:

Titre: Re : Vos montures en photos
Posté par: zack le 12 juillet 2010 à 20:39:31
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 13 juillet 2010 à 00:41:42
C'est un rail, par contre c'est un vrai camion a conduire. :-\ C'est hyper physique, il faut sans cesse sortir le cul pour tourner. Après une bonne arsouille t'est lessivé. mais dieu que c'est bon, quand t'as trouvé le mode d'emploi. :top:

d'où la dénomination "sportive"  ::)
Titre: Re : Vos montures en photos
Posté par: zack le 13 juillet 2010 à 18:36:05
Oui mais par rapport un R1 ou un gex  sont des vélos à coté :)
Titre: Re : Vos montures en photos
Posté par: Aleph le 16 juillet 2010 à 20:08:15
C'est un rail, par contre c'est un vrai camion a conduire. :-\ C'est hyper physique, il faut sans cesse sortir le cul pour tourner. Après une bonne arsouille t'est lessivé. mais dieu que c'est bon, quand t'as trouvé le mode d'emploi. :top:

Comme une SS ou pire ?
Titre: Re : Vos montures en photos
Posté par: zack le 16 juillet 2010 à 21:59:58
Piiiiiiire. J'ai eu un SSie (1000). A part la position plus contraignante du SS, a cause des poignées. (J'arrivais pas a m'y faire et j'ai même remplacé les bracelets par des Tomasellis réglable).  Elle est beaucoup plus facile a mener que le 888. ;)
Titre: Re : Vos montures en photos
Posté par: Sirene69 le 18 juillet 2010 à 09:45:53
voici ma mienne  ;)
un zx6r de 98 70000km

( (

( (

Titre: Re : Vos montures en photos
Posté par: MMM le 21 juillet 2010 à 07:39:20
voici ma mienne une tite gex k9

( (

( (

Titre: Re : Vos montures en photos
Posté par: Yoshms02 le 21 juillet 2010 à 09:53:57
Et voici mon joujou  ;D ;D ;D

( (

( (

( (

Titre: Re : Vos montures en photos
Posté par: Jeannot le 21 juillet 2010 à 13:58:58
Baptiste pkoi tu as fais la mise au point sur l'arbre de derriere c'est lui que tu chevauche le week end ?  :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 02 août 2010 à 14:28:12
bon ben j'ai re re re craqué  :2funny:

Ayant vendue la précédente en 2007, je regardais de temps à autre ce qui trainait en annonce pour m'en reprendre une.... soit la même soit la même mais en noir.

Samedi j'ai manqué la noir à 1/2 heure prêt... :-\

elle était belle...

Puis ce matin, en buvant mon café, je tombe sur celle qui m'a fait craqué en 98 dès sa sortie, celle ou en rentrant chez Bourgoin moto et la voyant sur le podium m'a fait dire.. je repars avec  :2funny:

Puis j'ai choisi de monter ma boite et pour cela ben fallait la vendre....

et là ben demain je serais à nouveau sur un CBR 98 et je partage ce moment avec vous  :)

place à la belle

place à la belle
Titre: Re : Vos montures en photos
Posté par: sphinx le 02 août 2010 à 14:35:37
féloche franck !!!  :top:

Titre: Re : Vos montures en photos
Posté par: Armène le 02 août 2010 à 15:11:57
Vivement demain alors  :D :D :D

 :top: Franck
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 02 août 2010 à 15:32:28
fireblade...   :love:
Titre: Re : Vos montures en photos
Posté par: perrine le 06 août 2010 à 19:33:51
voila comme promis je vous présente ma belle (g pas d'autre photo desolé, j'en ai pas encore prise depuis que je l'ai :-[ )

( (

d'ici peu elle aura 1 peu changé............................

voila ma 2e en version route
( (

et en version piste

( (

Titre: Re : Vos montures en photos
Posté par: zack le 06 août 2010 à 20:01:30
Sympa comme garage :top:
Titre: Re : Vos montures en photos
Posté par: 23 le 06 août 2010 à 20:29:07
Belle écurie  :top:
Titre: Re : Vos montures en photos
Posté par: jmf69150 le 06 août 2010 à 22:10:52
   HUMMM !!! jolies motos :top:
   HUMMM !!! belle position sur la moto :top:
   et jolie combarde Denise :top:
Titre: Re : Vos montures en photos
Posté par: idltalk le 07 août 2010 à 00:29:17
je suis loin d'être un pilote ... mais la position est zarbi je trouve. On dirait que frotte le pied pas le genou.
Moi ça m'arrive quand je positionne mon pied n'importe comment sur le cale pied.
En tous cas au niveau de l'angle que tu mets, c'est juste impressionnant, bravo  :top:
Titre: Re : Vos montures en photos
Posté par: perrine le 07 août 2010 à 00:52:38
je suis loin d'être un pilote ... mais la position est zarbi je trouve. On dirait que frotte le pied pas le genou.
Moi ça m'arrive quand je positionne mon pied n'importe comment sur le cale pied.
En tous cas au niveau de l'angle que tu mets, c'est juste impressionnant, bravo  :top:

exact la position est pas bonne!!

et en effet la botte et le cale pied frotte et pas le genou   :idiot:

d'habitude la position est mieux mais la bosse de la combi me genais (1ere sortie avec la combi) et du coup j'arrivais pas a sortir les epaules.

la derniere journee piste je suis arrivé a frotter le genou, y'a espoir................
Titre: Re : Vos montures en photos
Posté par: idltalk le 07 août 2010 à 02:02:20
Ouais à mon avis tu vas vite progresser toi  :top:
Titre: Re : Vos montures en photos
Posté par: fredingue le 07 août 2010 à 08:05:03
Très jolies photos...
Titre: Re : Vos montures en photos
Posté par: Francoistul le 07 août 2010 à 12:20:24
Très sympa le garage!! :top: :top:
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 10 août 2010 à 19:11:19
Pas besoin de présentation à rallonge, certains la connaissent déjà  >:D

Titre: Re : Vos montures en photos
Posté par: pop69 le 10 août 2010 à 21:10:36
non non... connais pas :2funny:
Titre: Re : Vos montures en photos
Posté par: Silent Phong le 10 août 2010 à 21:19:10
'faut finir de la roday  :2funny:
Titre: Re : Vos montures en photos
Posté par: guillaume le 11 août 2010 à 09:34:01
t'as fait une affaire  :top:
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 11 août 2010 à 10:40:44
Belle machine  ;D... ça me fait plaisir que ce soit toi qui l'ai  :top: ;)
Titre: Re : Vos montures en photos
Posté par: Viking le 11 août 2010 à 14:15:19
@ Perrine :  Ptain j'vais me faire pourrir  :-[
Titre: Re : Vos montures en photos
Posté par: Fireblade98 le 11 août 2010 à 16:41:55
bon ben voilà ma nouvelle... CBR  :)

Titre: Re : Vos montures en photos
Posté par: sphinx le 11 août 2010 à 16:53:09
 >:D >:D >:D
Titre: Re : Vos montures en photos
Posté par: Viking le 11 août 2010 à 18:41:44
 :love: :love:
Titre: Re : Vos montures en photos
Posté par: perrine le 11 août 2010 à 21:48:00
@ Perrine :  Ptain j'vais me faire pourrir  :-[

fallait pas faire ton malin a me proposer 1 balade.... ( (
Titre: Re : Vos montures en photos
Posté par: Warhead le 14 août 2010 à 16:38:47
( (,f57d70e0c358a28318b3ef5ef50b2de5.jpg.html)
Titre: Re : Vos montures en photos
Posté par: Salgoss le 23 août 2010 à 19:49:23
ma derniere:(
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 23 août 2010 à 22:55:29
bon ben voilà ma nouvelle... CBR  :)

 :top:   Fireblade nothing else  :D

( (,f57d70e0c358a28318b3ef5ef50b2de5.jpg.html)

joli coloris
Titre: Re : Vos montures en photos
Posté par: LaDy ReD 972 le 10 octobre 2010 à 15:10:38
Voici une photo de "Suzette" (mon 650 svs) et "Gexie" (le GSXR 750 de mon homme)

( (

Uploaded with (
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 11 octobre 2010 à 11:21:04
Bon après Buell, y a quoi ?  :o ! Ducat bien sur  :top:
Après 25 ans de permis, je me suis enfin décidé à essayer une sportive  :dead:

Après 2500 bornes sur les bracelets, je commence juste à sentir le potentiel de cette brelle, surtout depuis que j'ai franchement raccourci la transmission ! de 15 x 36 me voila en 14 x 39  :top:(faut pas toujours écouter les intégriste d'une marque..)

Mais je reconnais que je roule à des vitesses que j'avais juré ne plus atteindre sur route  :idiot: L'idéal serait de la consacrer uniquement à la piste, mais ça fait chéro le jouet.... :(
Je souhaite à tout motard de pouvoir avoir un jour un jouet pareil dans le garage, bien que les puristes ont toujours craché sur cette brelle, bah moi je l'  :love:

Voici donc ma 999 S de 2005  :P

Avec sa robe de pistarde  8) Qui d'ailleurs reste sa robe de balade aussi !
Titre: Re : Vos montures en photos
Posté par: Sam le 11 octobre 2010 à 13:03:52
belle machine  :top:
c'est sûr que ça doit changer  :)
Titre: Re : Vos montures en photos
Posté par: Joker le 11 octobre 2010 à 13:24:13
Ma mienne =)

Promis, dés que je récupère l'iphone, je ferais de plus belles photos ^^
Titre: Re : Vos montures en photos
Posté par: Ben le 11 octobre 2010 à 13:57:08
Bon après Buell, y a quoi ?  :o ! Ducat bien sur  :top:

Voici donc ma 999 S de 2005  :P

Avec sa robe de pistarde  8) Qui d'ailleurs reste sa robe de balade aussi !

 :love: :love: :love:
Titre: Re : Vos montures en photos
Posté par: Jazz le 11 octobre 2010 à 14:45:07
Voici donc ma 999 S de 2005  :P

Avec sa robe de pistarde  8) Qui d'ailleurs reste sa robe de balade aussi !

Vindiou ! Qu'est-ce qu'il est beau, ton jouet !
Je veux la même !
Tu me le prêtes ? Tu me le donnes ?  :D
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 11 octobre 2010 à 17:34:16
@Sam & Ben, merci  :top:
@Jazz, t'es trop jeune  :2funny:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 11 octobre 2010 à 17:42:00
Et Xerox te file combien pour avoir une police aussi grosse sur ta moto :geek: ;D
Titre: Re : Vos montures en photos
Posté par: Gianni le 11 octobre 2010 à 19:37:42
Vous l'avez pas assez vu? Ca tombe bien  >:D

( (
( (
Titre: Re : Vos montures en photos
Posté par: arthaud le 11 octobre 2010 à 19:46:05
Tu n'es pas vers l'église rue Pierre Brunier !!!
En tout cas elle est vraiment magnifique mais je ne t'ai jamais vu sur la route à caluire, je croise très souvent une daytona bleu
Titre: Re : Vos montures en photos
Posté par: Goyakla le 11 octobre 2010 à 20:04:48
C'est homologué ces pneus sur route :o

PS : la prochaine fois, diminue un peu le poids (et la taille) de tes photos ;)
Titre: Re : Vos montures en photos
Posté par: Grand Rémy le 11 octobre 2010 à 20:14:06
et cette fois ci attache la bien ! :2funny:
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 11 octobre 2010 à 22:41:23
belle bande de peur  ;D

je rigole, belle machine  ;) et que dire du photocopieur rouge! Il doit envoyer du bois sur piste  >:D
Titre: Re : Vos montures en photos
Posté par: dragonbuell le 12 octobre 2010 à 09:10:51
@Gianni, wahouuu la Dayto full black suis archi fan  :coolsmiley:
@Les autres, suis bien d'accord avec vous le Xerox j'aime po  >:( j'vais trouver un solution pour me débarrasser de ce truc !
Si non, oui sur piste elle envoie, y a juste le pilote qu' est po à la hauteur  ::)   
Titre: Re : Vos montures en photos
Posté par: Jazz le 12 octobre 2010 à 10:06:22
@Sam & Ben, merci  :top:
@Jazz, t'es trop jeune  :2funny:

Titre: Re : Vos montures en photos
Posté par: polyn le 12 octobre 2010 à 21:56:36
Voici une photo de "Suzette" (mon 650 svs) et "Gexie" (le GSXR 750 de mon homme)

( (

Uploaded with (

Joli svs ;)
Titre: Re : Vos montures en photos
Posté par: franck83 le 13 octobre 2010 à 21:11:30
( (

Uploaded with (
Titre: Re : Vos montures en photos
Posté par: Francoistul le 28 octobre 2010 à 21:15:31
Titre: Re : Vos montures en photos
Posté par: sebwhoops le 10 novembre 2010 à 12:52:28
Super belle ta Dayto Gianni !!!  :top:

bon allez je vous mets la mienne... les photos on un an et demi, faudrait que j'en reprenne, depuis j'ai mis pas mal de pièces carbone comme le garde boue avant, les caches sous la selle, les caches convoyeurs d'air, le protège pot, le protège chaine, le garde-boue arrière, et le cache pignon de sortie de boîte, et puis j'en passe peut-être... ah oui j'ai aussi enlevé les cales-pieds passagers, ça sert à rien...

( (

Uploaded with (

( (

Uploaded with (
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 10 novembre 2010 à 13:35:10
Superbe moto.  :top:

j'adore la jante arrière, bien mise en valeur par le monobras  8)
Titre: Re : Vos montures en photos
Posté par: sebwhoops le 11 novembre 2010 à 09:54:00
merci Marushin, c'est vrai que j'adore aussi ! :top:
j'aimais bien aussi la coupe de la 999, mais ce qui me gênais vraiment, c'était justement qu'il n'y avait pas de monobras !
Titre: Re : Vos montures en photos
Posté par: zack le 11 novembre 2010 à 10:25:32
C'est quand même  beau ces 1098 !!!! :top:
Titre: Re : Vos montures en photos
Posté par: toulousain le 19 novembre 2010 à 09:17:13
voiçi a mienne 
Titre: Re : Vos montures en photos
Posté par: airpébé le 19 novembre 2010 à 09:56:30
c'est la moto invisible de l'homme invisible  :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: toulousain le 19 novembre 2010 à 17:56:24 (

Titre: Re : Vos montures en photos
Posté par: Goyakla le 19 novembre 2010 à 18:07:54
Modèle carbus, plus de 40000 km de bonheur à son guidon :top:
Titre: Re : Vos montures en photos
Posté par: toulousain le 19 novembre 2010 à 18:13:05
ma moto toute noir j'ai enfin reussi,elle est visible :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: Armène le 01 décembre 2010 à 18:15:31
 ( moto toute noir j'ai enfin reussi,elle est visible :2funny: :2funny: :2funny:

Ouai, elle est visible  :)
Et pis j'aime bien aussi le barbeuk qui est aussi visible derrière  :D

Pour moi ce sera merguez  >:D
Titre: Re : Vos montures en photos
Posté par: toulousain le 01 décembre 2010 à 22:35:13
ok pour la barbeuk Armène,mais ce ne sera pas pour tout de suite,on va attendre un peu!!!!!!!!!!!!! :idiot: :2funny: :2funny: :2funny:
Posté le: 01 Décembre 2010 à 22:31:24
je voulais dire le barbeuk et pas la  :dead:
Titre: Re : Vos montures en photos
Posté par: banditmaniak600 le 10 décembre 2010 à 19:21:31
Une autre photo de mon tracteur :

( (
Titre: Re : Vos montures en photos
Posté par: akty le 14 décembre 2010 à 10:26:42
la 11s à la selle moillo grise et jaune est ma clémentine

ça commence à me prendre le chou là, çà fait x fois que j'essais de poster une tof de ma clémentine et il y a un hic dans la sauce 

Titre: Re : Vos montures en photos
Posté par: 23 le 14 décembre 2010 à 10:44:48
Pour mette une photo, tu cliques sur Parcourir, tu insères ta photo,ensuite tu cliques sur host it!, une fenêtre imageshack apparait avec la photo.
Tu copies le lien " Forum Code", et tu le colles dans ta réponse.
Titre: Re : Vos montures en photos
Posté par: akty le 14 décembre 2010 à 10:46:16
Pour mette une photo, tu cliques sur Parcourir, tu insères ta photo,ensuite tu cliques sur host it!, une fenêtre imageshack apparait avec la photo.
Tu copies le lien " Forum Code", et tu le colles dans ta réponse.

fait, refait ............. attente x tps rien ne passe grrrrrr
Titre: Re : Vos montures en photos
Posté par: Diabolo le 14 décembre 2010 à 11:38:01
Bah alors Akty il est pas blond pourtant ::) :2funny: :2funny: ;)
Titre: Re : Vos montures en photos
Posté par: akty le 14 décembre 2010 à 11:51:44
Bah alors Akty il est pas blond pourtant ::) :2funny: :2funny: ;)

ho je m'emmêle les béquilles av mon nouveau pc , mais y a autre chose là, pis le système tout en anglais je pige pas tout,

moi sorti de ail love you c'est plus mes oignons  :2funny:
Posté le: 14 Décembre 2010 à 11:43:26
la 11s à la selle moillo grise et jaune est ma clémentine
ça commence à me prendre le chou là, çà fait x fois que j'essais de poster une tof de ma clémentine et il y a un hic dans la sauce 

re essai :
re échec .............. gr..................

re essai................. et ?????

de 3/4 av

( (

lors du rassemblement de essistes flateux en haute loire à l'ascension, en guise d'ascension il tomba de la neige...................

( (

en prévisualisation ça passe , merci à lk23 de son aide, je suis pas sur d'avoir tout pigé mais bon
les médocs doivent grignoter le peu de matière grise qui me reste à mon âge avancé..........

j'essais de renvoyer , un tite prière heu ..............!


Titre: Re : Vos montures en photos
Posté par: 23 le 14 décembre 2010 à 12:03:00
De rien ;)

Jolie deudeutch :top:
Titre: Re : Vos montures en photos
Posté par: Rorschach le 14 décembre 2010 à 12:05:28
En mode "retour de balade", après 500 kms (à l'arrière plan, le CB de ma femme)



Titre: Re : Vos montures en photos
Posté par: akty le 14 décembre 2010 à 12:09:13
à par ça vous aimez pas le gris métalisé dans la famille

elle a une bonne bull*  cette dog


autre chose mmes mrs les anciens, existe t'il ici une rubrique : qu'avez vous amélioré ou personnalisé sur vos mobs ?
Titre: Re : Vos montures en photos
Posté par: Rorschach le 14 décembre 2010 à 12:13:17
à par ça vous aimez pas le gris métalisé dans la famille

elle a une bonne bull*  cette dog

La prochaine (d'ici quelques temps quand même) sera blanche et rouge... avec un tête de fourche et un moulin gros comme ça!!!  :_cheesy: :_cheesy: :_cheesy:
Titre: Re : Vos montures en photos
Posté par: akty le 14 décembre 2010 à 12:20:48
re essais sans aide de personne comme un marmot à ses premiers pas..........

une des rares éclaicies de ce we prolongé de mai 2010, les essistes venaient de toute la france et celui à tête raze est chuisse, pas petit en +

( (

Uploaded with (

bon ben apparement cette fois ci j'ai enfin pigé re merci à lk23
Titre: Re : Vos montures en photos
Posté par: NeNe le 14 décembre 2010 à 14:14:31
autre chose mmes mrs les anciens, existe t'il ici une rubrique : qu'avez vous amélioré ou personnalisé sur vos mobs ?

Il n'y à pas de rubrique personnalisation sur le forum, en revanche si tu en as envie tu peut presenter ta moto
ou les modifications dans cette section (Motos) , en ouvrant un nouveau fil de discussion  ;)
Titre: Re : Vos montures en photos
Posté par: akty le 14 décembre 2010 à 14:18:23
à par ça vous aimez pas le gris métalisé dans la famille

elle a une bonne bull*  cette dog

La prochaine (d'ici quelques temps quand même) sera blanche et rouge... avec un tête de fourche et un moulin gros comme ça!!!  :_cheesy: :_cheesy: :_cheesy:

ben justement en en parlant là il nous manque les lettres de ton moulin  ;)
Posté le: 14 Décembre 2010 à 14:16:53
autre chose mmes mrs les anciens, existe t'il ici une rubrique : qu'avez vous amélioré ou personnalisé sur vos mobs ?

Il n'y à pas de rubrique personnalisation sur le forum, en revanche si tu en as envie tu peut presenter ta moto
ou les modifications dans cette section (Motos) , en ouvrant un nouveau fil de discussion  ;)

oki merci dés que je peu je ferais des tofs en fonction
Titre: Re : Vos montures en photos
Posté par: maxim360 le 15 décembre 2010 à 18:39:35
voici ma ptite ZR7 !!! :)( (

Uploaded with (

By maxim360 ( at 2010-12-15

By maxim360 ( at 2010-12-15
Titre: Re : Vos montures en photos
Posté par: airpébé le 15 décembre 2010 à 18:45:03
voici ma ptite ZR7 !!! :)
a ouais quand même  :top: :top:  :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: maxim360 le 15 décembre 2010 à 18:46:45
desolé je cherche comment poster une photo!! je vais y arriver !!!!! :top:
Titre: Re : Vos montures en photos
Posté par: airpébé le 15 décembre 2010 à 18:47:40
tu la scannes dans "mes documents"
tu ouvres une 2eme fenêtre avec
tu clic sur parcourir (celui du haut)
tu fais un double clic sur le document
tu clic sur valider (celui du haut)
tu clic sur l'URL en dessous de ça pour bleuir :

Afficher directement l'image
Si l'image n'est pas trop grande , vous pouvez l'afficher directement , en taille réelle.
Sur un forum ( PHP BB , IPB , Pun BB > BBCode ) :

tu fais un copier
tu va sur le post de LM
tu colles

et voila ,l'image est en ligne
Titre: Re : Vos montures en photos
Posté par: maxim360 le 15 décembre 2010 à 19:09:28
sa y est j'ai reussi !! enfin  :P merci airpebé pour le reseignement j'ai fait pareil avec imageshack sa marche nikel !!! merci
Titre: Re : Vos montures en photos
Posté par: Jarod le 16 décembre 2010 à 20:24:10
Mon nouveau jouet :

( (
Titre: Re : Vos montures en photos
Posté par: Rorschach le 16 décembre 2010 à 20:30:45
Chouette, la moto de Jésus!  :P
Titre: Re : Vos montures en photos
Posté par: akty le 16 décembre 2010 à 21:04:41
d'habitude les triumph ont des lignes plus sexy

Titre: Re : Vos montures en photos
Posté par: Mehdingue le 16 décembre 2010 à 21:53:52
Mon nouveau jouet :

( (

 8) :top:
Titre: Re : Vos montures en photos
Posté par: fredingue le 17 décembre 2010 à 05:46:53
@ Jarod: Tu as réussi à vendre ton 955 ? C'est celle de Carter ?
Titre: Re : Vos montures en photos
Posté par: Jarod le 17 décembre 2010 à 18:27:08
@ Jarod: Tu as réussi à vendre ton 955 ? C'est celle de Carter ?

Oui, après 3 mois et demi j'ai enfin réussit a le vendre. Et celle-ci, non ce n'est pas celle de Carter. J'espère qu'il a réussit a la vendre.
Titre: Re : Vos montures en photos
Posté par: fredingue le 17 décembre 2010 à 19:15:57
Après la tof chez le concess, la voici dans le garage, à la place que tenais le CB:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 17 décembre 2010 à 19:21:13
Elle sert à quoi la petite roulette devant?  :D ;D
Titre: Re : Vos montures en photos
Posté par: fredingue le 17 décembre 2010 à 19:22:43
Euh c'est la remorque... :2funny: :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: El Bourrito le 17 décembre 2010 à 19:23:44
tu t'es fait plaiz mon salop feloch :top: :top: :top: :top: :top:
Titre: Re : Vos montures en photos
Posté par: Ptitducky le 17 décembre 2010 à 19:46:42
Euh c'est la remorque... :2funny: :2funny: :2funny: :2funny:

J'avais vu...mais bon on pourrait presque croire que c'est une option BMW :P
Titre: Re : Vos montures en photos
Posté par: 23 le 17 décembre 2010 à 20:29:38
Gaffe ma poule,à force de mettre de plus en plus de chevaux dans le garage, il n'y aura bientôt plus assez de place ;D
Titre: Re : Vos montures en photos
Posté par: fredingue le 17 décembre 2010 à 20:31:24
390ch dans l'écurie pour l'instant, y a encore de la place >:D >:D
Titre: Re : Vos montures en photos
Posté par: akty le 17 décembre 2010 à 20:51:34
Après la tof chez le concess, la voici dans le garage, à la place que tenais le CB:

mouai là j'ai un doute, sur qu'elle a dut fumer la CB pour obtenir la stendall ben de là à dire que la K13 tient la même place, heu là on dirait pô du 1/18ème
à moins que çà ne soit pas la même cébé, ben vi en hiver on sort les cébé pour faire du ski

 :2funny: :idiot: :2funny:
Titre: Re : Vos montures en photos
Posté par: fredingue le 17 décembre 2010 à 20:54:44
Le CB dont je parle c'est le CB1300F13 2003 Bracam' réplica que j'ai vendu il y a un mois
Titre: Re : Vos montures en photos
Posté par: akty le 17 décembre 2010 à 20:56:57
Le CB dont je parle c'est le CB1300F13 2003 Bracam' réplica que j'ai vendu il y a un mois

je m'en doutais ben un peu mais bon hein................. :2funny:
Titre: Re : Vos montures en photos
Posté par: zack le 23 décembre 2010 à 20:40:15
Pour rester dans les BMW. Mes 2 anciennes compagnes. Ducati 1000 ssie (2003) et BMW R60/7 (1978)

Titre: Re : Vos montures en photos
Posté par: sebwhoops le 03 janvier 2011 à 11:50:13
personne n'a eu de nouvelle monture en cadeau de noël ???
mais où est passé la magie des fêtes !!!  ;D
Titre: Re : Vos montures en photos
Posté par: fredingue le 03 janvier 2011 à 12:31:20
personne n'a eu de nouvelle monture en cadeau de noël ???
mais où est passé la magie des fêtes !!!  ;D
Si moi...Voir plus haut  ;D ;D
Titre: Re : Vos montures en photos
Posté par: sebwhoops le 04 janvier 2011 à 13:13:58
ah oui c'est vrai...  ;)
pas mal ! y'en a qui savent le faire avec leur femme !!  :top:
Titre: Re : Vos montures en photos
Posté par: fredingue le 04 janvier 2011 à 16:13:48
ah oui c'est vrai...  ;)
pas mal ! y'en a qui savent le faire avec leur femme !!  :top:

Leur quoi ???? :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: 23 le 04 janvier 2011 à 20:21:53
C'est justement parce qu'il n'en a pas qu'il à pu s'en acheter tu vois ce que je veux dire, Ma poule...
Titre: Re : Vos montures en photos
Posté par: Grand Rémy le 04 janvier 2011 à 22:01:02
la mienne:



(oui oui y'a aussi des trails sur LM...)
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 04 janvier 2011 à 23:16:07
J'aime beaucoup le coloris et surtout ton équipement qui invite au voyage  8)

...mais ça vaut pas un aftouine   :P

je plaisante, bel engin :top:
Titre: Re : Vos montures en photos
Posté par: legone le 04 janvier 2011 à 23:34:06
oooooh mais qu'ils sont jolis ces pare carters a l'avant ;) (put... j'en ai chie :D)
Titre: Re : Vos montures en photos
Posté par: Grand Rémy le 05 janvier 2011 à 00:46:57
oooooh mais qu'ils sont jolis ces pare carters a l'avant ;) (put... j'en ai chie :D)

yep merci a toi, la ce qui me démoralise c'est que je vais devoir faire la vidange d'huile avec le changement de filtre, seul hic pour acceder a tout ça faut faire tombé le sabot !! :dead:  quand je vois comme on en a chié pour fixé les vis dans ce foutu sabot.....
Posté le: 05 Janvier 2011, 00:45:51

...mais ça vaut pas un aftouine   :P

le problème de l'africa twin en occas', c'est son prix...  y'a trop d'abus et c'est ce pourquoi je n'ai jamais (pour l'instant) pu avoir cette moto !
Titre: Re : Vos montures en photos
Posté par: fredingue le 05 janvier 2011 à 05:57:06
C'est justement parce qu'il n'en a pas qu'il à pu s'en acheter tu vois ce que je veux dire, Ma poule...

Trop bien... :D :-\
Titre: Re : Vos montures en photos
Posté par: sebwhoops le 05 janvier 2011 à 10:41:07
tiens, j'ai retrouvé une chtiote photo de ma précédente monture ! une bonne brèle aussi  :top:
( (,8b23ab14f0b2c1a452f1363bb69bb9e0.jpg.html)

Posté le: 05 Janvier 2011 à 10:16:49
ah et puis pendant que j'y suis ma hornet :
( (,c34ebc57770dd71f4bf9fde369916979.jpg.html)
Titre: Re : Vos montures en photos
Posté par: zack le 05 janvier 2011 à 11:42:03
Elles sont ou tes photos ?  ::)
Titre: Re : Vos montures en photos
Posté par: sebwhoops le 05 janvier 2011 à 11:56:53
ah bin là je comprend pas... je les vois sur mon écran  :-\
bon, je vais recommencer la manip quand j'aurai le temps...
Titre: Re : Vos montures en photos
Posté par: pizzai69 le 05 janvier 2011 à 12:00:40
Moi je les vois.  ;)
Titre: Re : Vos montures en photos
Posté par: zack le 05 janvier 2011 à 12:02:26
Ça y est je les voient  ;)
Titre: Re : Vos montures en photos
Posté par: el pantasse le 05 janvier 2011 à 12:35:27
la premiere :love: :love:
Titre: Re : Vos montures en photos
Posté par: patlemur le 05 janvier 2011 à 16:41:29
( (

Uploaded with (
Titre: Re : Vos montures en photos
Posté par: sebwhoops le 05 janvier 2011 à 16:44:19
c'est mon modèle préféré en Gex ! sympa  :top:
Titre: Re : Vos montures en photos
Posté par: patlemur le 05 janvier 2011 à 16:58:40
Merci Sebwhoops !!!............ ;)
Titre: Re : Vos montures en photos
Posté par: NeNe le 18 janvier 2011 à 12:23:07
un autre 1000Gsxr  :love: :love:



Titre: Re : Vos montures en photos
Posté par: ReedSmith le 18 janvier 2011 à 19:44:12
c'est marrant cette caméra, au dessus du pot (et belle vidéo au passage)  :top:
Titre: Re : Vos montures en photos
Posté par: juexhaustenz le 18 janvier 2011 à 20:33:28
très bo gex voici la mienne xj6 n 2010

Posté le: 18 Janvier 2011, 20:30:41
( (

Uploaded with (

ma mienne  :)
Titre: Re : Vos montures en photos
Posté par: yann le 18 janvier 2011 à 23:29:15
photos prises dimanche


Titre: Re : Vos montures en photos
Posté par: zekoala le 24 janvier 2011 à 17:11:40
Rhâââââââââ.....  :love: :love: :love: :love: :love:
elle est trop belle cette brêle !
Titre: Re : Vos montures en photos
Posté par: mickey le 24 janvier 2011 à 18:00:49
Rhâââââââââ.....  :love: :love: :love: :love: :love:
elle est trop belle cette brêle !

Titre: Re : Vos montures en photos
Posté par: Tchok le 24 janvier 2011 à 18:47:44
La CBF 600 c'est facile et agréable même en duo ... mais pas seulement  :top:


Posté le: 24 Janvier 2011 à 18:45:15
Mais j'en voulais une assortie à la couleur de mes yeux  ::)

Titre: Re : Vos montures en photos
Posté par: 23 le 24 janvier 2011 à 20:16:32
Le regard de tueur, Nicolas.
Titre: Re : Vos montures en photos
Posté par: Milou le 24 janvier 2011 à 20:24:15
Le regard de tueur, Nicolas.
p'tain j'allais le dire, j'éspère qu'il y avait personne devant             :2funny:
Titre: Re : Vos montures en photos
Posté par: Tchok le 24 janvier 2011 à 20:29:19
Le regard de tueur, Nicolas.
:_cheesy: :_cheesy: :_cheesy:
       C O N C E N T R A T I O N            M A X I M A L E                                             :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: fredingue le 24 janvier 2011 à 20:35:19
"Le regard du tigre mec, le regard du tigre..."
Titre: Re : Vos montures en photos
Posté par: 23 le 24 janvier 2011 à 20:37:19
"Le regard du tigre mec, le regard du tigre..."

Presque Ma poule, c'est "L'oeil du tigre" ;)
Titre: Re : Vos montures en photos
Posté par: legone le 24 janvier 2011 à 20:39:48
moi, je sais qui etait devant, mais il a jamais reussi a le rattraper :D  >:D >:D >:D

ptetre cette annee :D (note a moi meme: penser a changer le freinage et a regler correctement la rampe de carbu avant la saison :D)
Titre: Re : Vos montures en photos
Posté par: fredingue le 24 janvier 2011 à 20:50:14
"Le regard du tigre mec, le regard du tigre..."

Presque Ma poule, c'est "L'oeil du tigre" ;)

Oups... Euh la San pélégrino c'est pas de l'alcool pourtant :geek: :idiot:
J'ai pensé oeil et tapé regard :2funny: :2funny: :2funny:
Titre: Re : Vos montures en photos
Posté par: ladouilleric le 01 février 2011 à 11:25:41
C'est ici qu'il faut viendre pour placer mes photos jolies...


Donc,à gauche VF1000R de 1984 et à droite VF1000F de 1985 qui a atterri dans le nid samedi!

Titre: Re : Vos montures en photos
Posté par: sebwhoops le 01 février 2011 à 14:06:31
C'est ici qu'il faut viendre pour placer mes photos jolies...


Donc,à gauche VF1000R de 1984 et à droite VF1000F de 1985 qui a atterri dans le nid samedi!

ah ouai... là c'est du mythique !! VF1000R la classe !  :top: mon père a eu un bon nombre d'année le VFF mais en 750, c'est un des premiers gros cube que j'ai essayé !! j'avais même pas encore mon permis !! je me rappelle du frein du moteur énorme, heureusement, parce que c'est pas les freins qui ya !!  :-\
ça doit bien marcher aussi en 1000 !
Titre: Re : Vos montures en photos
Posté par: 23 le 01 février 2011 à 14:15:31
Jolies les 2 VF :top:
Titre: Re : Vos montures en photos
Posté par: Flippe le 01 février 2011 à 15:34:44
Voila ma belle, toute nue et configuration voyage  :)

( (

( (

( (
Titre: Re : Vos montures en photos
Posté par: legone le 01 février 2011 à 16:21:04
Voila ma belle, toute nue et configuration voyage  :)

( (

 :love: :love: :love: :love: :love: :love: :love: :love: :love:
Titre: Re : Vos montures en photos
Posté par: Grand Rémy le 01 février 2011 à 16:28:56
enfin une belle triumph !! meu non les roastbeef je rigole !! :2funny: (y'a aussi la bonneville)
Titre: Re : Vos montures en photos
Posté par: sebwhoops le 03 février 2011 à 10:08:10
ouahou.. magnifique la trumph !!!  :love: :love: :love:
ça me plairait bien !
Titre: Re : Vos montures en photos
Posté par: Mehdingue le 04 février 2011 à 00:08:42
C'est ici qu'il faut viendre pour placer mes photos jolies...


Donc,à gauche VF1000R de 1984 et à droite VF1000F de 1985 qui a atterri dans le nid samedi!